Skip to content
Frontiers
Search

Original Research

Frontiers in Animal Science ·

Volume 7 - 2026 | https://doi.org/10.3389/fanim.2026.1921953

Effects of Cenchrus fungigraminus powder on growth performance, economic benefits, intestinal absorption, and liver antioxidant capacity in Hetian chickens

  • Xiao-Ming Gu1
  • Hai-Xuan Lv1
  • Yun Yang1
  • Zai-Xing Cai1
  • Chang-Kang Wang1
  • Ling Jin2*corresponding author
  • Yu-Yun Gao1*corresponding author
  1. 1Engineering Research Center for Animal Breeding and Sustainable Production, College of Animal Sciences, Fujian Agriculture and Forestry University, Fuzhou, China
  2. 2China National Engineering Research Center of JUNCAO Technology, Fujian Agriculture and Forestry University, Fuzhou, China
Article metrics0 viewsView details
PDFCiteMetrics

Abstract

Cenchrus fungigraminus, a high-quality unconventional feed resource, has potential application value in poultry production. This study aimed to investigate the effects of Cenchrus fungigraminus powder on growth performance, economic benefits, serum biochemistry, liver antioxidant capacity, and intestinal absorption in Hetian chickens. 288 31-day-old female Hetian chickens were randomly divided into 4 groups with 6 replicates per group and 12 chickens per replicate. The control (CON) group was fed the basal diet, while Groups I, II, and III were fed diets with 5%, 10%, and 15% of the basal diet replaced by Cenchrus fungigraminus powder, respectively. The test lasted for 30 days. Results showed that compared with the CON group, the average daily feed intake and feed-to-gain ratio in the 10% and 15% replacement groups were increased (p < 0.05). At a market price of 1.5 CNY/kg for Cenchrus fungigraminus powder, the 5% replacement group reduced the feed cost per kg weight gain by 1.055%, whereas the 10% and 15% replacement groups increased it. Additionally, serum total cholesterol levels in the 10% and 15% replacement groups were reduced (p < 0.05). Furthermore, the liver GSH/GSSG ratio in the 5% and 10% replacement groups, total antioxidant capacity in the 10% and 15% replacement groups, and catalase activity in the 10% replacement group were increased, while malondialdehyde content in the 5% replacement group was decreased (p < 0.05). Further analysis showed that the relative gizzard weight, relative ileum weight, and relative ileum length in the 10% and 15% replacement groups were increased (p < 0.05). Both ileal villus height in the 10% and 15% replacement groups and VH/CD ratio in the 5% and 10% replacement groups were increased (p < 0.05). Jejunal amylase activity was increased in all replacement groups, and ileal trypsin activity was increased in the 10% and 15% replacement groups (p < 0.05). Jejunal GLUT2 expression was upregulated in all replacement groups (p < 0.05). In summary, partial replacement of the basal diet with Cenchrus fungigraminus powder can reduce cholesterol levels, enhance liver antioxidant capacity, and improve intestinal digestion and absorption function in Hetian chickens, with the 5% replacement level showing the most favorable numerical trend in feed cost efficiency.

Keywords

1 Introduction

Feed serves as the foundation of the poultry farming industry, accounting for 65%-70% of total production costs (Banday et al., 2023). Corn and soybean meal, as the primary sources of energy and protein (Wilson et al., 2021), occupy a dominant position in the feed structure of China. However, in recent years, increased volatility in international grain markets has led to tighter supplies and sustained price increases for major feed ingredients such as soybean meal and corn, exposing the livestock industry to considerable cost and supply risks (Benoit and Mottet, 2023; Li, 2023; Shao et al., 2025). In response, the Chinese Ministry of Agriculture and Rural Affairs launched the “Program for Reducing Corn and Soybean Meal in Feed” in 2021 (Sun et al., 2023). This initiative aims to diversify and reduce the utilization of feed resources, thereby achieving grain savings and promoting more resource-efficient animal production. Against this backdrop, fully exploring and efficiently utilizing China’s abundant indigenous unconventional feed resources to replace conventional ingredients, such as corn and soybean meal, represents a strategic measure to lower production costs and ensure a stable feed ingredient supply (Fang et al., 2023).

Cenchrus fungigraminus (formerly referred to as Pennisetum giganteum in some literature)is a perennial gramineous plant of the genus Cenchrus (Song et al., 2025b). This species is characterized by high biomass yield, strong adaptability, and rich nutritional value. The crude protein content of annual Cenchrus fungigraminus ranges from 8% to 16% (on an air-dry basis). This level is comparable to premium leguminous forages, such as alfalfa (Medicago sativa). Moreover, it is significantly higher than several common gramineous forages, including Chinese wildrye (Leymus chinensis), oat hay (Avena sativa), and straw-based feeds. Its crude fat content parallels that of high-quality forages, while structural carbohydrates rank in the upper mid-spectrum among conventional forages (Lin, 2020; Qiu et al., 2023; Song et al., 2025a; Xing et al., 2023). Therefore, Cenchrus fungigraminus represents a highly promising unconventional feed resource.

Given these favorable nutritional characteristics, Cenchrus fungigraminus exhibits considerable feeding potential in livestock and poultry breeding. Qiu et al. (2022) showed that fermented Cenchrus fungigraminus mitigated the detrimental effects of heat stress in Boer goats by modulating gastrointestinal microbiota to enhance immune function, ultimately improving growth performance. Furthermore, Zhang et al. (2025) demonstrated that partial replacement of the basal diet with fresh, lush-green Cenchrus fungigraminus exerted no significant impact on the growth performance of finishing Congjiang Xiang pigs, while improving cost efficiency and enhancing gut health. Additionally, Omoor et al. (2024) have shown that dietary supplementation with fermented Cenchrus fungigraminus can enhance the immune level and improve the health status of white-feathered broilers. However, research on the application of Cenchrus fungigraminus in broilers remains limited, and no studies have systematically evaluated its dose-dependent effects on growth performance, intestinal health, antioxidant capacity, and economic benefits in slow-growing yellow-feathered broilers.

Hetian chicken, a famous slow-growing Chinese yellow-feathered broiler breed indigenous to the Fujian region, holds significant economic importance in local poultry production systems. Despite its relatively small slaughter weight compared to fast-growing broiler breeds, the Hetian chicken has established a substantial market presence in China due to its superior meat quality characteristics, including a delicious flavor, distinct aroma, and tender texture (Gu and Li, 2020; Zhang et al., 2025). In light of the current industry demands for developing unconventional feed resources and improving cost efficiency while reducing production costs in poultry farming, this experiment was conducted on Hetian chickens at the mid-growth stage. The objective was to investigate the effects of partially replacing the basal diet with Cenchrus fungigraminus powder on growth performance, economic benefits, serum biochemistry, liver antioxidant capacity, and intestinal absorption. Based on a comprehensive analysis of these parameters, the optimal substitution percentage will be determined to provide theoretical guidance for its application in poultry farming. Furthermore, this study aims to provide a reference for exploring and developing unconventional feed resources to support the further utilization of unconventional feed resources in poultry production.

2 Materials and methods

2.1 Experimental design, animals, and diets

A total of 288 31-day-old female Hetian chickens (purchased from Lanxiu Family Farm, Changting County, Fujian Province, China) were randomly divided into 4 groups with 6 replicates per group and 12 chickens per replicate. According to the experimental design of Zhang et al (Zhang et al., 2025), the control (CON) group was fed the basal diet, while Group I (5% replacement), Group II (10% replacement), and Group III (15% replacement) were fed diets with 5%, 10%, and 15% of the basal diet replaced by Cenchrus fungigraminus powder, respectively. The experimental diets were formulated using a direct replacement approach rather than an isoenergetic and isonitrogenous design due to practical and economic considerations. Since the inclusion of Cenchrus fungigraminus powder inherently alters the energy and protein composition of the diet, adjusting the formulation to achieve strict isoenergetic and isonitrogenous conditions would require substantial supplementation of high-cost protein and energy sources (e.g., soybean meal, soybean oil). This adjustment would not only significantly increase feed costs but also deviate from the practical application scenario. Cenchrus fungigraminus powder was purchased from Liancheng Junnong Ecological Technology Co., Ltd., and feed raw materials were purchased from Fujian Jinhualong Feed Co., Ltd. The entire experimental period lasted for 30 days. The basal diets were formulated according to the Nutrition Requirements of Yellow-feathered Broiler by the Ministry of Agriculture and Rural Affairs of China (NY/T3645-2020). The composition of ingredients and nutritional levels are shown in Table 1. The nutritional level of Cenchrus fungigraminus powder is shown in Table 2.

Table 1. Composition and nutrient levels of diets (air-dry basis, %).

ItemsContent(%)
CONGroup IGroup IIGroup III
Ingredients
Corn66.6563.3360.0056.66
Soybean meal17.7816.8916.0015.11
Expanded soybean12.0011.4010.8010.20
Cenchrus fungigraminus0.005.0010.0015.00
DL-Methionine0.130.120.110.11
Soybean oil0.280.260.250.24
Limestone powder1.181.121.061.00
Dicalcium phosphate0.630.590.560.53
L-Lysine Hydrochloride0.050.050.050.04
NaCl0.300.290.270.26
1% Premix11.000.950.900.85
Total100.00100.00100.00100.00
Nutrient levels2
Metabolizable energy(MJ/kg)12.6012.1411.6911.23
Crude protein17.5017.2216.9416.66
Crude fiber2.584.436.298.15
Neutral detergent fiber9.0012.2315.4618.69
Acid detergent fiber4.216.168.1110.06
Calcium0.720.700.690.67
Available phosphorus0.260.250.250.26
Lysine0.930.920.900.88
Methionine + Cystine0.690.670.650.64

1Premix was provided per kg diet: vitamin A 9000 IU, vitamin D3–500 IU, vitamin E 35 IU, vitamin K3 2.2 mg, vitamin B1 2.30 mg, vitamin B2–5 mg, vitamin B6 2.40 mg, vitamin B12 0.015 mg, biotin 0.10 mg, folic acid 0.7 mg, nicotinic acid 35 mg, pantothenic acid 10 mg, Choline chloride 1000 mg, Mn 60 mg, Fe 80 mg, Zn 80 mg, Cu 7 mg, I 0.60 mg, Se 0.15 mg.

2Nutrient levels were calculated values.

Table 2. The nutritional level of Cenchrus fungigraminus powder (air-dry basis, %).

ItemsContent(%)
Ingredients
Crude protein11.91
Crude fat2.4
Crude fiber39.7
Crude ash8.3
Neutral detergent fiber73.6
Acid detergent fiber43.2
Calcium0.37
Phosphorus0.11

This experiment was conducted in the Poultry Laboratory of Fujian Agriculture and Forestry University. The Hetian chickens were raised in enclosed poultry houses and housed in single-tier cages with 12 broilers per cage (1562.5 cm2/bird). During the experimental period, the ambient temperature was maintained at 24 ± 2 °C, with relative humidity of 60-70%. The lighting program followed a 16 h light:8 h dark schedule, with light intensity of 20 lx. All chickens were vaccinated against Newcastle disease and infectious bronchitis at 7 and 21 days of age according to standard commercial protocols. Throughout the experimental period, chickens had unrestricted access to feed and water. All the experimental procedures applied in this study were reviewed and approved by the Committee of Animal Experiments of Fujian Agriculture and Forestry University (Fuzhou, Fujian, China, approval ID PZCASFAFU24019).

2.2 Sample collection

On day 30 of the trial, two chickens from each replicate, with body weights close to the replicate average, were randomly selected for sample collection. Blood samples were collected from the wing vein and allowed to clot at room temperature, followed by centrifugation at 1,000 × g for 15 minutes at 4 °C to separate the serum. The collected serum was stored at -20 °C until analysis. After blood collection, the chickens were humanely euthanized. Subsequently, samples of liver tissue, as well as jejunal and ileal mucosa, were collected and immediately stored at -80 °C for further analysis.

2.3 Growth performance and economic benefit analysis

The weight of each replication was recorded on Days 1 and 30 of the experiment, and feed intake (per replication) was recorded every day. The average daily gain (ADG), average daily feed intake (ADFI), and feed-to-gain ratio (F/G) were calculated for the chickens.

Based on the total feed consumption and respective prices of the basal diet and Cenchrus fungigraminus powder during the experimental period, the feed cost per kg weight gain and feed cost reduction percentage were calculated.

Feed cost per kg weight gain (CNY/kg) =(Total feed intake × Feed price)/(Final body weight − Initial body weight)

Feed cost reduction percentage (%) = [ (Feed cost per kg weight gain of experimental group − Feed cost per kg weight gain of control group)/Feed cost per kg weight gain of control group ] × 100

2.4 Serum biochemistry

Serum biochemical parameters, including glucose (GLU), triglycerides (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), glutamic transaminase (AST), glutamic aminotransferase (ALT), total protein (TP), and urea nitrogen (BUN), were measured using a BS-280 automated biochemical analyzer (Shenzhen Mindray Bio-Medical Electronics Co., Ltd., Guangdong, China).

2.5 Liver antioxidant indicators

Liver samples were collected, rinsed with physiological saline at 4 °C, and blotted dry with filter paper. Then, 0.1 g of liver tissue was weighed. The tissue sample was transferred to a grinding tube, and physiological saline was added at a ratio of 1:9 (weight: volume). The mixture was mechanically homogenized in an ice-water bath to prepare a 10% (w/v) homogenate. The homogenate was centrifuged at 3,500 r/min for 10 minutes, and the supernatant was collected for subsequent analysis. Commercial kits (Nanjing Jiancheng Biotechnology Co., Ltd., Nanjing, China) were used to determine the activities of glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), catalase (CAT), and γ-glutamylcysteine synthetase (γ-GCS), as well as the levels of total antioxidant capacity (T-AOC), malondialdehyde (MDA), and the glutathione (GSH)/glutathione disulfide (GSSG) ratio. All procedures were performed strictly in accordance with the manufacturer’s instructions.

2.6 Relative gastrointestinal tract weight and length

The proventriculus, gizzard, duodenum, jejunum, ileum, and cecum were isolated after slaughter. Following digesta removal, absolute weights were recorded gravimetrically for subsequent computation of relative gastrointestinal tract weight. Measurements of the absolute intestinal segments (duodenum, jejunum, ileum, and cecum) were performed on fresh tissues immediately after collection to determine relative lengths.

Relative gastrointestinal tract weight (g/kg) = Absolute gastrointestinal tract weight (g)/Body weight (kg)

Relative intestinal length (cm/kg) = Absolute intestinal length (cm)/Body weight (kg)

2.7 Jejunal and ileal histomorphological observation

Jejunal and ileal samples were collected for histomorphological analysis. Tissues were fixed in 4% paraformaldehyde, paraffin-embedded, sectioned, and stained with hematoxylin and eosin. Images of stained sections were captured under a light microscope (Nikon Corporation, Japan). Villus height (VH) and crypt depth (CD) were measured using Image Pro Plus 6.0 software (Media Cybernetics, CA, United States), and the VH/CD ratio was calculated.

2.8 Digestive enzyme activity

The method for preparing the supernatant of jejunal and ileal mucosal tissue was the same as that for the liver. The activities of lipase, amylase, and trypsin in the jejunal and ileal mucosa were determined using commercial kits (Nanjing Jiancheng Biotechnology Co., Ltd., Nanjing, China). All procedures were performed strictly in accordance with the manufacturer’s instructions.

2.9 qRT-PCR

Gene expression analysis was performed following the protocol established in our previous study (Gao et al., 2025). Briefly, total RNA was extracted from jejunal and ileal mucosa samples using the SteadyPure RNA extraction kit (Hunan Accurate Biology Co., Ltd., Hunan, China). RNA concentration and purity were assessed with a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific Corporation, Wilmington, NC, USA). Subsequently, complementary DNA (cDNA) was synthesized from total RNA via reverse transcription using the NovoScript® Plus All-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge) kit (Suzhou Novoprotein Scientific Co., Ltd., Jiangsu, China). Quantitative real-time PCR (qRT-PCR) was carried out on a fluorescence quantitative PCR instrument (Bio-Rad Laboratories Co., Ltd., Shanghai, China) using the NovoStart® Universal Fast SYBR qPCR SuperMix kit (Suzhou Novoprotein Scientific Co., Ltd., Jiangsu, China). All primers (detailed in Table 3) were designed and synthesized by Shanghai Shenggong Biological Engineering Co., Ltd. The β-Actin gene served as the internal reference, and relative expression levels of target genes were calculated using the 2-ΔΔCT method.

Table 3. Primer sequences and amplification parameters of reference and target genes.

GenePrimer sequence (5’→3’)Accession number
β-ActinF: GAGAAATTGTGCGTGACATCAR: CCTGAACCTCTCATTGCCANM_205518
PepT1F: AGACTGGGCAAGCGAGAAGTR: TGCCCAGAACATCGGGAGAGNM_204365.2
SGLT1F: GCCATGGCCAGGGCTTAR: CAATAACCTGATCTGTGCACCAGTANM_001293240.2
GLUT2F: ATGACGGTTGGACTTGTGCTR: CAATGAAGTTGCAGGCCCAGNM_207178.1
EAAT3F: TGCTGCTTTGGATTCCAGTGTR: AGCATGACTGTAGTGCAGAAGTAATATATXM_424930.8

2.10 Data analysis and statistics

The data were analyzed using one-way ANOVA, followed by Duncan’s multiple range test with the software SPSS 26. (SPSS Inc., Chicago, IL). To assess the dose-effect relationship of Cenchrus fungigraminus powder, linear and quadratic contrast analyses were performed simultaneously. The results are presented as the mean ± standard deviation. p < 0.05 was considered statistically significant.

3 Results

3.1 Growth performance and economic benefit analysis

As shown in Table 4, compared with the CON group, the ADFI and F/G of Hetian chickens in the 10% and 15% replacement groups were increased (p < 0.05). No differences were observed in IBW, FBW, and ADG between the CON group and all replacement groups (p > 0.05).

Table 4. Effects of Cenchrus fungigraminus powder on the growth performance and economic benefits of Hetian chickens1.

ItemsGroups2P-values3
CONGroup IGroup IIGroup IIIANOVALinearQuadratic
Growth performance
IBW, g221.35 ± 2.08220.94 ± 1.89221.49 ± 2.09221.92 ± 1.850.8570.5340.607
FBW, g646.34 ± 7.53ab652.84 ± 5.59a645.32 ± 6.57ab639.72 ± 7.16b0.0260.0380.040
ADFI, g44.08 ± 1.86c45.36 ± 1.97bc46.88 ± 1.13ab47.40 ± 1.28a0.0070.0010.566
ADG, g14.66 ± 0.30ab14.89 ± 0.21a14.62 ± 0.28ab14.41 ± 0.27b0.0410.0500.055
F/G3.01 ± 0.13b3.05 ± 0.14b3.21 ± 0.11a3.29 ± 0.11a0.002<0.0010.685
Economic benefits
Feed cost per kg weight gain (CNY/kg)8.060 ± 0.3477.975 ± 0.3698.203 ± 0.2858.210 ± 0.2650.5250.2580.726
Feed cost reduction percentage (%)0.0001.055-1.774-1.861

1IBW, Initial body weight; FBW, Final body weight; ADFI, average daily feed intake; ADG, average daily gain; F/G=feed-to-gain ratio. The feed price was calculated based on the market price of raw materials during the experiment; Cenchrus fungigraminus powder was calculated for 1.5 CNY/kg. 2CON=basal diet; Group I = 5% replacement; Group II = 10% replacement; Group III=15% replacement. The same as in the table below. 3Values are the mean ± SD, n=6. a-c Means within each row with no common superscript differ significantly(p < 0.05).

When Cenchrus fungigraminus powder was priced at 1.5 CNY/kg, no differences were observed in feed cost per kg weight gain among all groups (p > 0.05). However, compared with the CON group, the 5% replacement group reduced the feed cost per kg weight gain by 1.055%. In contrast, the 10% and 15% replacement groups increased it by 1.774% and 1.861%, respectively.

3.2 Serum biochemistry

As shown in Table 5, compared with the CON group, the serum TC level of Hetian chickens was decreased in both the 10% and 15% replacement groups (p < 0.05). However, there were no differences in other serum biochemical indices among the groups (p > 0.05).

Table 5. Effects of Cenchrus fungigraminus powder on serum biochemical indexes of Hetian chickens1.

ItemsGroupsP-values2
CONGroup IGroup IIGroup IIIANOVALinearQuadratic
GLU (mmol/L)10.37 ± 0.4610.35 ± 0.3910.34 ± 0.3510.06 ± 0.500.6150.2780.501
TG (mmol/L)0.40 ± 0.070.37 ± 0.080.35 ± 0.060.33 ± 0.060.5040.1460.751
TC (mmol/L)2.37 ± 0.12a2.26 ± 0.09ab2.22 ± 0.09b2.18 ± 0.08b0.0340.0060.425
HDL-C (mmol/L)1.52 ± 0.161.53 ± 0.111.62 ± 0.111.64 ± 0.090.2930.0740.898
LDL-C (mmol/L)0.73 ± 0.100.69 ± 0.070.65 ± 0.050.64 ± 0.050.2530.0550.663
BUN (mmol/L)0.66 ± 0.110.62 ± 0.130.60 ± 0.100.58 ± 0.080.6900.2480.839
TP (g/L)38.10 ± 2.6438.66 ± 0.8739.26 ± 0.6440.18 ± 1.520.2490.0510.807
ALT (U/L)6.40 ± 1.145.60 ± 1.145.80 ± 0.846.20 ± 1.100.6290.8530.224
AST (U/L)232.00 ± 10.93227.80 ± 11.05228.80 ± 9.36231.00 ± 9.410.9090.9230.494

<sup>1</sup>GLU, glucose; TG, triglycerides; TC, total cholesterol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; AST, glutamic transaminase; ALT, glutamic aminotransferase; TP, total protein; BUN, urea nitrogen. 2Values are the mean ± SD, n=6. a,b Means within each row with no common superscript differ significantly (p < 0.05).

3.3 Liver antioxidant indicators

As shown in Table 6, the liver GSH/GSSG ratio of Hetian chickens in the 5% and 10% replacement groups was increased compared with the CON group (p < 0.05). Meanwhile, the T-AOC in the 10% and 15% replacement groups was also higher than that in the CON group (p < 0.05). Furthermore, compared with the CON group, the MDA content in the 5% replacement group was decreased, while the CAT activity in the 10% replacement group was increased (p < 0.05). There were no differences in other liver antioxidant indices among all groups (p > 0.05).

Table 6. Effects of Cenchrus fungigraminus powder on antioxidant indexes in the liver of Hetian chickens1.

ItemsGroupsP-values2
CONGroup IGroup IIGroup IIIANOVALinearQuadratic
GSH-PX (U/mg prot)161.27 ± 12.82164.90 ± 0.39168.31 ± 13.24162.90 ± 10.660.8080.7310.407
SOD (U/mg prot)74.46 ± 7.3081.84 ± 6.2278.35 ± 8.0184.40 ± 8.820.1600.0740.834
CAT (U/mg prot)18.98 ± 2.54b19.51 ± 2.32b23.57 ± 2.07a20.94 ± 2.26ab0.0110.0280.108
γ-GCS (U/mg prot)3.24 ± 0.863.13 ± 0.803.84 ± 0.803.59 ± 0.520.3560.2100.820
T-AOC (mmol/g prot)0.15 ± 0.03b0.17 ± 0.02ab0.22 ± 0.06a0.21 ± 0.02a0.0140.0030.352
MDA (nmol/mg prot)2.38 ± 0.44b1.75 ± 0.14a2.57 ± 0.59b2.70 ± 0.50b0.0080.0420.053
GSH/GSSG1.31 ± 0.24b1.97 ± 0.22a2.07 ± 0.67a1.58 ± 0.29ab0.0120.2270.002

1GSH-Px, glutathione peroxidase; SOD, superoxide dismutase; CAT, catalase; γ-GCS, γ-glutamylcysteine synthetase; T-AOC, total antioxidant capacity; MDA, malondialdehyde; GSH/GSSG, glutathione/glutathione disulfide ratio. 2Values are the mean ± SD, n=6. a,b Means within each row with no common superscript differ significantly (p < 0.05).

3.4 Relative gastrointestinal tract weight and length

From Table 7, it can be seen that compared with the CON group, the relative gizzard weight, relative ileum weight, and relative ileum length of Hetian chickens in the 10% and 15% replacement groups were increased (p < 0.05). However, there were no differences in other gastrointestinal tract relative weight and length indices among the groups (p > 0.05).

Table 7. Effects of Cenchrus fungigraminus powder on relative gastrointestinal tract weight and length of Hetian chickens.

ItemsGroupsP-values1
CONGroup IGroup IIGroup IIIANOVALinearQuadratic
Relative weight (g/kg)
Proventriculus6.47 ± 0.866.50 ± 0.576.90 ± 0.877.12 ± 1.200.2440.0530.718
Gizzard26.76 ± 1.78b28.11 ± 1.51ab28.61 ± 2.47a29.35 ± 1.68a0.0140.0020.583
Duodenum16.96 ± 1.8017.12 ± 1.2117.32 ± 0.7017.78 ± 1.090.4220.1100.669
Jejunum22.45 ± 2.0223.17 ± 1.2023.44 ± 2.8123.59 ± 1.650.5220.1620.628
Ileum14.82 ± 1.32b15.50 ± 1.89ab16.06 ± 0.91a16.38 ± 1.30a0.0480.0060.656
Cecum6.38 ± 0.566.52 ± 0.696.68 ± 0.346.83 ± 0.690.2850.0540.973
Relative length (cm/kg)
Duodenum38.65 ± 3.0540.74 ± 4.5140.87 ± 1.7340.93 ± 2.670.2380.0940.272
Jejunum66.36 ± 4.9768.66 ± 8.4970.22 ± 4.8570.25 ± 8.380.4770.1450.572
Ileum58.80 ± 3.93b61.43 ± 5.62ab62.63 ± 1.29a63.78 ± 3.26a0.0190.0020.508
Cecum40.89 ± 3.9441.54 ± 2.2442.02 ± 1.6442.89 ± 1.750.2880.0560.882

1Values are the mean ± SD, n=6. a,b Means within each row with no common superscript differ significantly (p < 0.05).

3.5 Jejunal and ileal histomorphology

As shown in Table 8, compared with the CON group, the ileal VH of Hetian chickens in the 10% and 15% replacement groups was increased (p < 0.05). Meanwhile, the ileal VH/CD ratio in the 5% and 10% replacement groups was also higher than that in the CON group (p < 0.05). However, there were no differences in jejunal VH, CD, and VH/CD ratio, as well as ileal CD, among all groups (p > 0.05).

Table 8. Effects of Cenchrus fungigraminus powder on the intestinal morphologic structure of Hetian chickens1.

ItemsGroupsP-values2
CONGroup IGroup IIGroup IIIANOVALinearQuadratic
Jejunum
VH(μm)1053.22 ± 79.041121.46 ± 88.531145.34 ± 86.811095.63 ± 85.160.3050.3420.105
CD(μm)215.94 ± 10.79209.97 ± 11.47205.20 ± 10.32211.45 ± 10.550.4090.3660.181
VH/CD4.88 ± 0.365.37 ± 0.655.60 ± 0.625.20 ± 0.630.2130.2700.077
Ileum
VH(μm)822.63 ± 26.91b848.98 ± 32.13ab886.99 ± 29.57a877.07 ± 49.19a0.0220.0060.226
CD(μm)148.14 ± 10.56131.93 ± 11.67139.51 ± 10.54142.89 ± 16.110.1810.7230.068
VH/CD5.58 ± 0.54b6.46 ± 0.42a6.40 ± 0.62a6.18 ± 0.53ab0.0380.0900.021

1VH, villus height; CD, crypt depth; CAT, catalase; VH/CD, villus height/crypt depth ratio. 2Values are the mean ± SD, n=6. a,b Means within each row with no common superscript differ significantly (p < 0.05).

3.6 Digestive enzyme activity

As shown in Table 9, compared with the CON group, the jejunal amylase activity of Hetian chickens in all replacement groups was increased (p < 0.05). Meanwhile, the ileal trypsin activity in the 10% and 15% replacement groups was also higher than that in the CON group (p < 0.05). However, there were no significant differences in jejunal lipase and trypsin activities, as well as ileal amylase and lipase activities, among all groups (p > 0.05).

Table 9. Effects of Cenchrus fungigraminus powder on the intestinal mucosal enzyme activity of Hetian chickens.

ItemsGroupsP-values1
CONGroup IGroup IIGroup IIIANOVALinearQuadratic
Jejunum
Lipase(U/g prot)40.81 ± 7.8539.34 ± 8.1436.24 ± 6.3446.59 ± 8.650.1700.3300.078
Amylase(U/mg prot)2.31 ± 0.31b2.87 ± 0.31a2.81 ± 0.33a2.74 ± 0.35a0.0270.0480.026
Trypsin(U/mg prot)320.16 ± 15.07348.15 ± 32.87346.96 ± 31.22325.97 ± 59.130.4800.8170.130
Ileum
Lipase(U/g prot)28.70 ± 3.5425.81 ± 3.7026.93 ± 3.6225.57 ± 3.300.4260.2160.604
Amylase(U/mg prot)1.55 ± 0.151.63 ± 0.161.65 ± 0.151.66 ± 0.140.5900.2090.616
Trypsin(U/mg prot)236.65 ± 20.80b250.85 ± 20.87ab284.17 ± 31.44a276.31 ± 36.02a0.0280.0080.348

1Values are the mean ± SD, n=6. a,b Means within each row with no common superscript differ significantly (p < 0.05).

3.7 Gene expression of nutrient transporters

As shown in Figure 1, compared with the CON group, the expression of jejunal GLUT2 was increased in all replacement groups (p < 0.05). There were no differences in the expression levels of other jejunal nutrient transporters among all groups (p > 0.05).

Effects of *Cenchrus fungigraminus* powder on gene expression of nutrient transport proteins in the jejunum of Hetian chickens. CON=basal diet; I = 5% replacement; II = 10% replacement; III=15% replacement. The bars represent the mean ± SD, n=6. Error bars represent SD. <sup>a,b</sup> Means within each row with no common superscript differ significantly (*p* < 0.05). The same as in the figure below.
Figure 1. Effects of Cenchrus fungigraminus powder on gene expression of nutrient transport proteins in the jejunum of Hetian chickens. CON=basal diet; I = 5% replacement; II = 10% replacement; III=15% replacement. The bars represent the mean ± SD, n=6. Error bars represent SD. a,b Means within each row with no common superscript differ significantly (p < 0.05). The same as in the figure below.

As shown in Figure 2, there were no differences in the expression levels of ileal nutrient transporters among all groups (p > 0.05).

Effects of *Cenchrus fungigraminus* powder on gene expression of nutrient transport proteins in the ileum of Hetian chickens.
Figure 2. Effects of Cenchrus fungigraminus powder on gene expression of nutrient transport proteins in the ileum of Hetian chickens.

4 Discussion

Growth performance is an important index to evaluate the feeding effect of the diet and reflect the growth of animals. It includes F/G, ADFI, and ADG during the feeding period (Jie et al., 2024). Cenchrus fungigraminus powder, due to its rich nutrient composition, can be used as a potential unconventional feed ingredient and is expected to improve the growth performance of Hetian chickens. However, our results showed that replacing 5%, 10%, and 15% of the basal diet with Cenchrus fungigraminus powder did not significantly affect the FBW and ADG of Hetian chickens. Moreover, replacing 10% and 15% of the basal diet with Cenchrus fungigraminus powder significantly increased the ADFI and F/G. Given that Cenchrus fungigraminus powder is rich in dietary fiber, similar to California-type almond hulls and crude fiber-based diets, we compared our findings with studies using these materials. Consistent with our research, Wang et al. (2021) showed that a diet containing 9% California-type almond hulls significantly increased feed intake (FI) and feed conversion ratio(FCR) of Cobb 500 male broilers. Similarly, Zhang et al. (2023) showed that the ADFI of Arbor Acres (AA) broilers in the 5% crude fiber and 8% crude fiber groups was significantly higher than that in the 2% crude fiber group. These studies suggest that the increase in ADFI may be partially attributable to the general physiological response to a lower-energy-density diet, requiring increased feed consumption by poultry to meet their growth requirements. However, this compensatory increase in feed intake did not fully offset the reduced nutrient availability, thereby leading to unchanged ADG and elevated F/G (Agyekum and Nyachoti, 2017; Classen, 2017).

Feed cost is an important factor affecting the economic benefits of animal husbandry. Due to rising global feed prices, the poultry sector is increasingly turning to non-conventional feed resources as substitutes for traditional ingredients to reduce feed costs (Sugiharto and Ranjitkar, 2019). Based on this, we further investigated the effect of Cenchrus fungigraminus powder on the economic benefits of Hetian chickens. Our findings demonstrated that a 5% dietary substitution with Cenchrus fungigraminus powder (1.5 CNY/kg) was cost-effective, reducing feed cost per kg weight gain by 1.055%. Conversely, substitutions of 10% and 15% led to cost increases of 1.774% and 1.861% per kg of weight gain. Research by Jiwuba et al. (2018) demonstrated that incorporating 8% and 12% of Siam weed (Chromolaena odorata) leaf meal (SWLM) into broiler diets reduced feed cost per daily weight gain. In addition, Madzimure et al. (2018) found that adding 50 g/kg Acacia angustissima leaf meal to the broiler diet increased the average income by $0.19 per broiler. However, adding 100 g/kg Acacia angustissima leaf meal to the broiler diet, the average income per broiler decreased by $0.76. These findings are consistent with our results. Taken together, unconventional feed can reduce feed costs to a certain extent. However, in actual production, the proportion of unconventional feed addition or substitution requires careful consideration of its cost, nutritional value, and impact on animal growth performance. The appropriate proportion can improve the economic benefits, while an excessive proportion may diminish them instead.

Serum biochemical parameters are important biomarkers for evaluating animal health and physiological status (Lebednikaitė et al., 2024). Our study found that replacing 10% and 15% of the basal diet with Cenchrus fungigraminus powder significantly reduced the serum TC level of Hetian chickens, while other serum biochemical indicators (GLU, TG, HDL-C, LDL-C, BUN, TP, ALT, AST) showed no significant difference between the groups. These biochemical parameters did not show significant differences among the groups, indicating that substituting 5%, 10%, and 15% of the basal diet with Cenchrus fungigraminus powder did not adversely affect systemic metabolism and liver function of Hetian chickens. The reduction in serum TC level may be attributed to the high dietary fiber content of Cenchrus fungigraminus powder. Studies have shown that dietary fiber can reduce cholesterol levels in sows (Shang et al., 2021), chickens (Weiss and Scott, 1979), and mice (Liu et al., 2021) by binding intestinal bile acids, reducing cholesterol reabsorption, and promoting its excretion. Furthermore, studies have indicated that dietary fiber can be fermented by gut microbiota to produce short-chain fatty acids (SCFAs) (Eaton et al., 2022). These SCFAs can modulate liver lipid uptake and lipoprotein metabolism, and reduce cholesterol synthesis by inhibiting β-hydroxy-β-methylglutaryl-CoA (HMG-CoA) reductase (Ju et al., 2023), thereby lowering cholesterol levels. However, the stable levels of TG, HDL-C, and LDL-C indicate that Cenchrus fungigraminus powder has a selective effect on lipid metabolism, likely primarily acting on cholesterol metabolism rather than the overall lipid metabolic network. Taken together, we hypothesize that partially replacing the basal diet with Cenchrus fungigraminus powder exerts a positive regulatory effect on the serum TC level of Hetian chickens.

Oxidative stress is a central issue affecting the overall health of chickens in modern production systems. It is characterized by a dynamic imbalance between the body’s oxidative system and antioxidant defense system, leading to excessive accumulation of reactive oxygen species (ROS) and reactive nitrogen species (RNS). This subsequently causes damage to biological macromolecules such as proteins, lipids, and DNA, ultimately inducing various metabolic dysfunctions and cellular damage (Birch‐Machin and Bowman, 2016; Oke et al., 2024; Sies et al., 2017). The liver, as the central organ for detoxification and metabolism, not only reduces free radical generation through efficient detoxification mechanisms but also actively participates in the synthesis of various antioxidant enzymes, which is crucial for maintaining the body’s overall antioxidant capacity (Alía et al., 2003; Li et al., 2015). Therefore, we investigated the effects of partially replacing the basal diet with Cenchrus fungigraminus powder on the liver antioxidant capacity of Hetian chickens. The results showed that substitution levels of 10% and 15% significantly increased liver T-AOC, and the 10% substitution level also significantly increased liver CAT activity. This finding is corroborated by studies using different fiber sources. For example, Omoor et al. (2024) found that dietary supplementation with 10% and 15% fermented Cenchrus fungigraminus significantly increased serum T-AOC and the activities of SOD and CAT in AA broilers. Wang et al. (2022) reported that dietary supplementation with 3% ramie powder significantly increased serum GSH-Px activity in laying hens, while supplementation with 6% ramie powder significantly increased liver SOD activity. These studies indicate that incorporating an appropriate level of fiber into the diet can enhance the function of the antioxidant enzyme system in poultry, although the effects of different fiber sources on specific antioxidant enzyme activities may vary. Our study further found that replacing 5% and 10% of the basal diet with Cenchrus fungigraminus powder significantly increased the liver GSH/GSSG ratio in Hetian chickens, and the 5% substitution level significantly decreased liver MDA content. MDA is a terminal product of lipid peroxidation (Turcu et al., 2022), and its reduced content directly reflects the attenuation of liver lipid peroxidation damage. Meanwhile, the GSH/GSSG ratio is a key biomarker reflecting the body’s redox status. Its increase indicates an enhanced antioxidant defense capacity and a shift towards a healthier redox homeostasis (Czarnecka et al., 2020; Zitka et al., 2012). The elevated GSH/GSSG ratio, together with the decreased MDA content, constitutes strong evidence for the alleviation of oxidative damage by Cenchrus fungigraminus powder. These results are consistent with previous studies. For instance, Omoor et al. (2024) also found that supplementation with 15% fermented Cenchrus fungigraminus significantly reduced serum MDA content in AA broilers. In conclusion, the results of this study suggest that partially replacing the basal diet with Cenchrus fungigraminus powder may positively influence the liver antioxidant function of Hetian chickens by enhancing liver total antioxidant capacity and catalase activity, optimizing glutathione redox balance, and inhibiting lipid peroxidation.

The gastrointestinal tract is the foundation for animal health, growth, and development. Its functional status directly affects the efficiency of nutrient digestion and absorption, immune system function, and metabolic homeostasis within the organism (Lenfestey and Neu, 2018). The relative weight and length of the gastrointestinal tract are key indicators for evaluating the digestive tract development in broilers. These parameters can reflect the metabolic activity and physiological function of the digestive tract to some extent (Juanchich et al., 2021). Jiménez-Moreno et al. (2009) found that adding oat hulls to the diet significantly increased the relative gizzard weight of broilers. Another study showed that a diet containing 8% crude fiber significantly increased the relative lengths of the ileum and cecum of broilers (Zhang et al., 2023). Our results showed that replacing 10% and 15% of the basal diet with Cenchrus fungigraminus powder (which is rich in insoluble dietary fibers like cellulose and hemicellulose) significantly increased the relative gizzard weight, the relative ileum weight, and the relative ileum length of Hetian chickens, a finding consistent with the above research results. In general, birds adapt to fiber-rich diets by increasing the volume and weight of the digestive tract. The gizzard, as the core organ for mechanical digestion, is particularly stimulated by insoluble fiber. The presence of these rigid, non-fermentable particles enhances the contraction of its muscular walls and grinding efficiency, thereby inducing a compensatory hypertrophy and increase in weight. In contrast to soluble fiber, which can increase intestinal viscosity and slow passage rate, insoluble fiber primarily increases digesta retention time by providing mechanical resistance and stimulating gizzard motility, which in turn regulates the controlled release of digesta into the small intestine. This prolonged retention and mechanical stimulation further promote the growth and development of the intestine, leading to the observed increases in its relative weight and length (J. Tejeda and K. Kim, 2021; Jiménez-Moreno et al., 2009).

The small intestine is the primary site for nutrient digestion and absorption, and the integrity of its morphological structure is fundamental to maintaining intestinal health and normal physiological function (Zhan et al., 2025). Among its features, VH, CD, and the VH/CD ratio are key microscopic indicators for evaluating the structure and functional status of the intestine (Ducatelle et al., 2018). Numerous studies have demonstrated that an appropriate amount of dietary fiber positively influences intestinal morphology. For instance, Shang et al. (2020) found that dietary supplementation with 30 g/kg wheat bran significantly increased the VH and VH/CD ratio in the jejunum and ileum of AA broilers. Bogusławska-Tryk et al. (2020) reported that dietary inclusion of 0.5% and 1% lignocellulose significantly increased the CD in the jejunum, as well as the VH, CD, and VH/CD ratio in the ileum of Ross 308 broilers. Similarly, Rezaei et al. (2011) indicated that adding different levels of insoluble fiber (0.3%, 0.4%, and 0.5%) to the diet of Ross 308 broilers linearly increased the VH/CD ratio in the ileum. Our results showed that replacing 10% and 15% of the basal diet with Cenchrus fungigraminus powder significantly increased ileal VH in Hetian chickens, while substitution levels of 5% and 10% significantly increased the ileal VH/CD ratio. These findings are generally consistent with the aforementioned studies. The mechanism by which Cenchrus fungigraminus powder improves intestinal morphology may be related to two characteristics of its dietary fiber. First, dietary fiber can be fermented by gut microbiota to produce energy substrates (e.g., SCFAs), which provide energy to intestinal epithelial cells, promoting their proliferation and differentiation, thereby optimizing intestinal structure (Zhang et al., 2023). Second, the physical properties of fiber may indirectly influence villus development by stimulating intestinal peristalsis and mucosal renewal (Sacranie et al., 2012). In summary, we hypothesize that partially replacing the basal diet with Cenchrus fungigraminus powder can improve the intestinal morphology of Hetian chickens, thereby facilitating the digestion and absorption of nutrients.

Digestive enzymes, such as amylase, lipase, and protease, play a crucial role in catalyzing the breakdown of nutrients within the small intestine (Jiao et al., 2025). Their activity levels directly influence the efficiency of carbohydrate, lipid, and protein digestion and utilization in poultry (Chen et al., 2024). Previous studies have shown that dietary fiber can modulate intestinal digestive enzyme activity. For example, Song et al. (2024) found that dietary supplementation with Moringa oleifera leaf powder linearly increased α-amylase activity in the duodenum and jejunum of Ningdu yellow chickens, with the 1% supplementation level also significantly increasing jejunal trypsin activity. Shang et al. (2020) reported that dietary inclusion of 30 g/kg wheat bran significantly increased the activities of amylase and trypsin in the jejunum of AA broilers. These studies collectively indicate that an appropriate level of fiber in the diet can enhance intestinal digestive enzyme activity. The results of the present study are consistent with these findings. Specifically, replacing 5%, 10%, and 15% of the basal diet with Cenchrus fungigraminus powder significantly increased jejunal amylase activity in Hetian chickens. Furthermore, at the 10% and 15% substitution levels, ileal trypsin activity was also significantly increased. As a dietary fiber source rich in structural carbohydrates, Cenchrus fungigraminus powder may promote digestive enzyme activity through several mechanisms. First, both this study and previous research have observed improvements in intestinal morphology (e.g., increased VH and elevated VH/CD ratio) resulting from dietary fiber, which may provide a more favorable physiological microenvironment for the secretion and function of digestive enzymes. Second, dietary fiber may modulate the secretion of gastrointestinal hormones, such as cholecystokinin (CCK), stimulating the pancreas to secrete more digestive proenzymes into the intestinal lumen. These proenzymes are then effectively activated within the intestinal lumen, thereby enhancing overall digestive enzyme activity (Kheravii et al., 2018; Svihus, 2011). In summary, this study demonstrates that partially replacing the basal diet with Cenchrus fungigraminus powder can increase intestinal digestive enzyme activity in Hetian chickens. Considering the positive effects observed on intestinal morphology, we hypothesize that Cenchrus fungigraminus powder likely promotes nutrient digestion and absorption through the synergistic improvement of both intestinal structure and the activity of key digestive enzymes.

Transporters expressed on the brush border membrane and basolateral membrane of intestinal epithelial cells are key to achieving efficient nutrient absorption (Kaminski and Wong, 2018). Specifically, glucose is primarily taken up into enterocytes via active transport by SGLT1 on the brush border membrane. Intracellular glucose is then facilitated down its concentration gradient into the bloodstream via GLUT2 on the basolateral membrane, thus completing the intestinal absorption process of glucose (Shibata et al., 2019; Sun et al., 2023). PepT1 is a high-capacity, low-affinity transporter that mediates the proton-dependent co-transport of dipeptides and tripeptides in the intestine (Smith et al., 2013). EAAT3 is primarily responsible for the transmembrane transport of free glutamate and aspartate across the brush border membrane (Biolley et al., 2019). Based on the central role of these transporters in nutrient absorption, we investigated the effects of Cenchrus fungigraminus powder on the expression levels of SGLT1, GLUT2, PepT1, and EAAT3 in the intestine of Hetian chickens. The results showed that replacing 5%, 10%, and 15% of the basal diet with Cenchrus fungigraminus powder significantly increased the expression of GLUT2 in the jejunum of Hetian chickens. This upregulation suggests that partially replacing the basal diet with Cenchrus fungigraminus powder may enhance carbohydrate absorption efficiency by strengthening the capacity of jejunal epithelial cells to transport glucose into the bloodstream. This finding aligns with the general pattern observed in existing research, where dietary fiber components can regulate the expression of intestinal glucose transporters. For instance, Liu et al. (2023) demonstrated that increasing dietary fiber levels using wheat bran as a fiber source significantly upregulated the expression of SGLT1 and GLUT2 in the jejunum of Xiangcun pigs. Similarly, Kheravii et al. (2018) found that dietary supplementation with sugarcane bagasse upregulated GLUT2 expression levels in the jejunum of Ross 308 broilers. The upregulation of jejunal GLUT2 expression in Hetian chickens by Cenchrus fungigraminus powder may be attributed to the jejunum being the primary site for monosaccharide absorption (Toschi et al., 2024), rendering its regulatory response to glucose transporters more sensitive. In addition, this study simultaneously found that Cenchrus fungigraminus powder increased jejunal amylase activity. We speculate that the underlying mechanism may be as follows: the increase in amylase activity promotes the efficient breakdown of starch into glucose, thereby generating higher levels of glucose transporter substrates, which in turn induce the upregulation of GLUT2 expression to adapt to and accelerate nutrient absorption. However, in this study, Cenchrus fungigraminus powder did not significantly affect the expression levels of PepT1, SGLT1, and EAAT3 in the jejunum, nor the expression levels of all detected transporter proteins in the ileum. This may be attributed to factors such as the dosage of Cenchrus fungigraminus powder, the physiological characteristics of different intestinal segments of Hetian chickens, and differences in the regulatory mechanisms of transporter proteins.

Notably, the direct substitution strategy employed in this study does not allow complete separation of the specific contribution of Cenchrus fungigraminus powder from the effects of nutrient dilution. Therefore, we plan to adopt isoenergetic and isonitrogenous formulations in future studies to further validate the specific role of this ingredient.

5 Conclusion

In conclusion, partial replacement of the basal diet with Cenchrus fungigraminus powder can reduce cholesterol levels, enhance liver antioxidant capacity, and improve intestinal digestion and absorption function in Hetian chickens. From an economic perspective, the 5% replacement level demonstrated the most favorable numerical trend in feed cost efficiency under the conditions of this study. However, this conclusion is based solely on feed cost analysis. Comprehensive economic evaluations incorporating total production costs are warranted in future research. These findings suggest that Cenchrus fungigraminus powder shows potential as a feed resource for slow-growing local chicken breeds. However, given that this study was conducted over a 30-day period in a single breed (Hetian chickens), further research is warranted to evaluate its long-term effects, efficacy in other breeds and production stages, and applicability under different management systems before broader recommendations can be made.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Footnotes

Edited by: Soumaya Boukrouh, Mohammed VI Polytechnic University, Morocco

Reviewed by: Zhen Dong, Hunan Agricultural University, China

Deka Fahrodi, Universitas Sulawesi Barat, Indonesia

Statements

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This study was supported by the National Natural Science Foundation of China (31802079), Modern Poultry Industry Technology System of Fujian Province (KLY24403XA), National Key Research and Development Program of China (2023YFD1600500), Agricultural Guiding (Key) Project of Fujian Provincial Science and Technology Department (2023N0008), Science and Technology Development Projects Funded by Chinese Central and Local Governments (2022L3085), Science and Technology Innovation Special Fund Project of Fujian Agriculture and Forestry University (KFB23099A).

Data availability

The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.

Ethics approval

The animal study was approved by The Committee of Animal Experiments of Fujian Agriculture and Forestry University (Fuzhou, Fujian, China, approval ID PZCASFAFU24019). The study was conducted in accordance with the local legislation and institutional requirements.

Author contributions

X-MG: Writing – review & editing, Writing – original draft. H-XL: Investigation, Data curation, Conceptualization, Formal analysis, Writing – review & editing. YY: Software, Methodology, Validation, Writing – review & editing. Z-XC: Writing – review & editing, Validation, Visualization, Supervision, Investigation. C-KW: Writing – review & editing, Project administration, Methodology. LJ: Writing – review & editing, Visualization, Methodology, Resources, Project administration. Y-YG: Resources, Writing – review & editing, Funding acquisition, Project administration.

References

  1. Agyekum A. K., Nyachoti C. M. (2017). Nutritional and metabolic consequences of feeding high-fiber diets to swine: A review. Engineering 3, 716 – 725. doi: doi:10.1016/J.ENG.2017.03.010
  2. Alía M., Horcajo C., Bravo L., Goya L. (2003). Effect of grape antioxidant dietary fiber on the total antioxidant capacity and the activity of liver antioxidant enzymes in rats. Nutr. Res. 23, 1251 – 1267. doi: doi:10.1016/S0271-5317(03)00131-3
  3. Banday M. T., Adil S., Sheikh I. U., Hamadani H., Qadri F. I., Sahfi M. E.. (2023). The use of silkworm pupae (Bombyx mori) meal as an alternative protein source for poultry. World's Poultry Sci. J. 79, 119 – 134. doi: doi:10.1080/00439339.2023.2163955
  4. Benoit M., Mottet A. (2023). Energy scarcity and rising cost: Towards a paradigm shift for livestock. Agric. Syst. 205, 103585. doi: doi:10.1016/j.agsy.2022.103585
  5. Biolley C., Tretola M., Bee G., Jud C., Silacci P. (2019). Punicalagin increases glutamate absorption in differentiated Caco-2 cells by a mechanism involving gene expression regulation of an EAAT3 transporter. Food. Funct. 10, 5333 – 5338. doi: doi:10.1039/C9FO00191C
  6. Birch‐Machin M. A., Bowman A. (2016). Oxidative stress and ageing. Br. J. Dermatol. 175, 26 – 29. doi: doi:10.1111/bjd.14906
  7. Bogusławska-Tryk M., Bogucka J., Dankowiakowska A., Walasik K. (2020). Small intestine morphology and ileal biogenic amines content in broiler chickens fed diets supplemented with lignocellulose. Livest. Sci. 241, 104189. doi: doi:10.1016/j.livsci.2020.104189
  8. Chen X., Zheng A., Chen Z., Pirzado S. A., Wang Z., Chen J.. (2024). Potassium diformate affects the growth and development of broilers by improving intestinal function and digestive enzyme activity. Poult. Sci. 103, 104049. doi: doi:10.1016/j.psj.2024.104049
  9. Classen H. L. (2017). Diet energy and feed intake in chickens. Anim. Feed Sci. Technol. 233, 13 – 21. doi: doi:10.1016/j.anifeedsci.2016.03.004
  10. Czarnecka A. M., Hilgier W., Zielińska M. (2020). S-Adenosylmethionine deficiency and brain accumulation of S-adenosylhomocysteine in thioacetamide-induced acute liver failure. Nutrients 12, 2135. doi: doi:10.3390/nu12072135
  11. Ducatelle R., Goossens E., De Meyer F., Eeckhaut V., Antonissen G., Haesebrouck F.. (2018). Biomarkers for monitoring intestinal health in poultry: Present status and future perspectives. Vet. Res. 49, 43. doi: doi:10.1186/s13567-018-0538-6
  12. Eaton S. E., Kaczmarek J., Mahmood D., McDiarmid A. M., Norarfan A. N., Scott E. G.. (2022). Exploiting dietary fibre and the gut microbiota in pelvic radiotherapy patients. Br. J. Cancer 127, 2087 – 2098. doi: doi:10.1038/s41416-022-01980-7
  13. Fang Q., Zhang X., Dai G., Tong B., Wang H., Oenema O.. (2023). Low-opportunity-cost feed can reduce land-use-related environmental impacts by about one-third in China. Nat. Food 4, 677 – 685. doi: doi:10.1038/s43016-023-00813-x
  14. Gao Y.-Y., Lin Z.-X., Zhang M., Yang R., Guo P.-T., Zhang J.. (2025). Health effects of astaxanthin in the intestinal tract of yellow-feathered broilers. Poult. Sci. 104, 104768. doi: doi:10.1016/j.psj.2025.104768
  15. Gu J., Li S. (2020). The complete mitochondrial genome and phylogenetic analysis of the Hetian chicken (Gallus gallus). Mitochondrial DNA Part B 5, 2865 – 2867. doi: doi:10.1080/23802359.2020.1791020
  16. Jiao Y., Huang W., Zhang Q., Liu L., Zhao J., Chen Y. (2025). Inactivated Lactiplantibacillus plantarum Ps-8 enhances growth performance and intestinal health in broiler chickens via gut microbiota and serum metabolite modulation. Poult. Sci. 104, 105611. doi: doi:10.1016/j.psj.2025.105611
  17. Jie Y., Wen C., Huang Q., Gu S., Sun C., Li G.. (2024). Distinct patterns of feed intake and their association with growth performance in broilers. Poult. Sci. 103, 103974. doi: doi:10.1016/j.psj.2024.103974
  18. Jiménez-Moreno E., González-Alvarado J. M., de Coca-Sinova A., Lázaro R., Mateos G. G. (2009). Effects of source of fibre on the development and pH of the gastrointestinal tract of broilers. Anim. Feed Sci. Technol. 154, 93 – 101. doi: doi:10.1016/j.anifeedsci.2009.06.020
  19. Jiwuba P. C., Ogbuewu I. P., Nwachukwuguru K. (2018). Performance and economy of production of broilers fed Siam weed (Chromolaena odorata) leaf meal (SWLM). Trop. Anim. Health Prod. 50, 1305 – 1311. doi: doi:10.1007/s11250-018-1559-x
  20. J. Tejeda O., K. Kim W. (2021). Role of dietary fiber in poultry nutrition. Animals 11, 461. doi: doi:10.3390/ani11020461
  21. Ju Y., Huang L. L., Luo H. L., Huang Y. C., Huang X. Y., Chen G.. (2023). Passion fruit peel and its zymolyte enhance gut function in Sanhuang broilers by improving antioxidation and short-chain fatty acids and decreasing inflammatory cytokines. Poult. Sci. 102, 102672. doi: doi:10.1016/j.psj.2023.102672
  22. Juanchich A., Urvoix S., Hennequet-Antier C., Narcy A., Mignon-Grasteau S. (2021). Phenotypic timeline of gastrointestinal tract development in broilers divergently selected for digestive efficiency. Poult. Sci. 100, 1205 – 1212. doi: doi:10.1016/j.psj.2020.11.013
  23. Kaminski N. A., Wong E. A. (2018). Differential mRNA expression of nutrient transporters in male and female chickens. Poult. Sci. 97, 313 – 318. doi: doi:10.3382/ps/pex262
  24. Kheravii S. K., Swick R. A., Choct M., Wu S.-B. (2018). Upregulation of genes encoding digestive enzymes and nutrient transporters in the digestive system of broiler chickens by dietary supplementation of fiber and inclusion of coarse particle size corn. BMC Genomics 19, 208. doi: doi:10.1186/s12864-018-4592-2
  25. Lebednikaitė E., Sutkevičienė N., Vilkonienė T., Balčiauskienė Ž., Kučinskas K., Anskienė L.. (2024). Serum biochemical parameters of broilers affected by wooden breast myopathy. Animals 14, 1499. doi: doi:10.3390/ani14101499
  26. Lenfestey M. W., Neu J. (2018). Gastrointestinal development: Implications for management of preterm and term infants. Gastroenterol. Clinics North. America 47, 773 – 791. doi: doi:10.1016/j.gtc.2018.07.005
  27. Li L. (2023). Commodity prices volatility and economic growth: Empirical evidence from natural resources industries of China. Resour. Policy 80, 103152. doi: doi:10.1016/j.resourpol.2022.103152
  28. Li S., Tan H.-Y., Wang N., Zhang Z.-J., Lao L., Wong C.-W.. (2015). The role of oxidative stress and antioxidants in liver diseases. Int. J. Mol. Sci. 16, 26087 – 26124. doi: doi:10.3390/ijms161125942
  29. Lin Z. X. (2020). “ Research and application of JUNCAO and microbial feed technologies,” in China Animal Industry. Beijing, China: China Animal Husbandry, 73 – 74.
  30. Liu J., Luo Y., Kong X., Yu B., Zheng P., Huang Z.. (2023). Influences of wheat bran fiber on growth performance, nutrient digestibility, and intestinal epithelium functions in Xiangcun pigs. Heliyon 9 (7). doi: doi:10.1016/j.heliyon.2023.e17699
  31. Liu J., Wang Y., Xue L., Nie C., Sun J., Fan M.. (2021). Novel metabolic regulation of bile acid responses to low cholesterol in whole-grain-diet-fed mice. J. Agric. Food. Chem. 69, 8440 – 8447. doi: doi:10.1021/acs.jafc.1c02662
  32. Madzimure J., Motsi R., Bakare A. G., Zimondi M. (2018). Growth performance, economic benefits and sensory characteristics of meat from broilers finished on Acacia anguistissima leaf meal-based diets. Trop. Anim. Health Prod. 50, 1485 – 1491. doi: doi:10.1007/s11250-018-1585-8
  33. Oke O. E., Akosile O. A., Oni A. I., Opowoye I. O., Ishola C. A., Adebiyi J. O.. (2024). Oxidative stress in poultry production. Poult. Sci. 103, 104003. doi: doi:10.1016/j.psj.2024.104003
  34. Omoor I. N. A., Yankey R., Shehata A. I., Fang C. H., Hui L., Dongmei L.. (2024). Dietary supplement of fermented grass forage regulates growth performance, antioxidant capacity, and immune response of broiler chickens. Poult. Sci. 103, 103323. doi: doi:10.1016/j.psj.2023.103323
  35. Qiu Y., Lei Y., Zhao H., He X., Liu B., Huang Y. (2023). Mesophilic anaerobic digestion of Arundo donax cv. Lvzhou No. 1 and Pennisetum giganteum for biogas production: Structure and functional analysis of microbial communities. Bioenergy Res. 16, 1205 – 1216. doi: doi:10.1007/s12155-022-10496-0
  36. Qiu Y., Zhao H., He X., Zhu F., Zhang F., Liu B.. (2022). Effects of fermented feed of Pennisetum giganteum on growth performance, oxidative stress, immunity and gastrointestinal microflora of Boer goats under thermal stress. Front. Microbiol. 13. doi: doi:10.3389/fmicb.2022.1030262
  37. Rezaei M., Karimi Torshizi M. A., Rouzbehan Y. (2011). The influence of different levels of micronized insoluble fiber on broiler performance and litter moisture. Poult. Sci. 90, 2008 – 2012. doi: doi:10.3382/ps.2011-01352
  38. Sacranie A., Svihus B., Denstadli V., Moen B., Iji P. A., Choct M. (2012). The effect of insoluble fiber and intermittent feeding on gizzard development, gut motility, and performance of broiler chickens. Poult. Sci. 91, 693 – 700. doi: doi:10.3382/ps.2011-01790
  39. Shang Q., Liu S., Liu H., Mahfuz S., Piao X. (2021). Impact of sugar beet pulp and wheat bran on serum biochemical profile, inflammatory responses and gut microbiota in sows during late gestation and lactation. J. Anim. Sci. Biotechnol. 12, 54. doi: doi:10.1186/s40104-021-00573-3
  40. Shang Q., Wu D., Liu H., Mahfuz S., Piao X. (2020). The impact of wheat bran on the morphology and physiology of the gastrointestinal tract in broiler chickens. Animals 10, 1831. doi: doi:10.3390/ani10101831
  41. Shao Y.-H., Gao X.-L., Yang Y.-H., Zhou W.-X. (2025). Joint multifractality in cross-correlations between grains & oilseeds indices and external uncertainties. Financial Innovation 11, 21. doi: doi:10.1186/s40854-024-00669-5
  42. Shibata M., Takahashi T., Kozakai T., Kakudo M., Kasuga S., Azuma Y.. (2019). Active transport of glucose across the jejunal epithelium decreases with age in broiler chickens. Poult. Sci. 98, 2570 – 2576. doi: doi:10.3382/ps/pez002
  43. Sies H., Berndt C., Jones D. P. (2017). Oxidative stress. Annu. Rev. Biochem. 86, 715 – 748. doi: doi:10.1146/annurev-biochem-061516-045037
  44. Smith D. E., Clémençon B., Hediger M. A. (2013). Proton-coupled oligopeptide transporter family SLC15: Physiological, pharmacological and pathological implications. Mol. Aspects Med. 34, 323 – 336. doi: doi:10.1016/j.mam.2012.11.003
  45. Song S., Zhou H., Luo Y., Yu S., Su D., Zheng D.. (2025 a). Effects of waterlogging at different duration on growth and physiological characteristics of Cenchrus fungigraminus. Environ. Exp. Bot. 231, 106096. doi: doi:10.1016/j.envexpbot.2025.106096
  46. Song S., Zhou H., Yue R., Yu S., Su D., Zheng D.. (2025 b). Morphological and photosynthetic characteristics of Cenchrus fungigraminus under different waterlogging stress. Ind. Crops Prod. 237, 122149. doi: doi:10.1016/j.indcrop.2025.122149
  47. Song Q., Zou Z., Chen X., Ai G., Xiong P., Song W.. (2024). Effect of Moringa oleifera leaf powder supplementation on growth performance, digestive enzyme activity, meat quality, and cecum microbiota of Ningdu yellow chickens. Agriculture 14, 1523. doi: doi:10.3390/agriculture14091523
  48. Sugiharto S., Ranjitkar S. (2019). Recent advances in fermented feeds towards improved broiler chicken performance, gastrointestinal tract microecology and immune responses: A review. Anim. Nutr. 5, 1 – 10. doi: doi:10.1016/j.aninu.2018.11.001
  49. Sun B., Chen H., Xue J., Li P., Fu X. (2023). The role of GLUT2 in glucose metabolism in multiple organs and tissues. Mol. Biol. Rep. 50, 6963 – 6974. doi: doi:10.1007/s11033-023-08535-w
  50. Sun H., Kang X., Tan H., Cai H., Chen D. (2023). Progress in fermented unconventional feed application in monogastric animal production in China. Fermentation 9, 947. doi: doi:10.3390/fermentation9110947
  51. Svihus B. (2011). The gizzard: function, influence of diet structure and effects on nutrient availability. World's Poultry Sci. J. 67, 207 – 224. doi: doi:10.1017/S0043933911000249
  52. Toschi A., Yu L., Bialkowski S., Schlitzkus L., Grilli E., Li Y. (2024). Dietary supplementation of microencapsulated botanicals and organic acids enhances the expression and function of intestine epithelial digestive enzymes and nutrient transporters in broiler chickens. Poult. Sci. 103, 104237. doi: doi:10.1016/j.psj.2024.104237
  53. Turcu V., Wild P., Hemmendinger M., Sauvain J.-J., Bergamaschi E., Hopf N. B.. (2022). Towards reference values for malondialdehyde on exhaled breath condensate: A systematic literature review and meta-analysis. Toxics 10, 258. doi: doi:10.3390/toxics10050258
  54. Wang J., Singh A. K., Kong F., Kim W. K. (2021). Effect of almond hulls as an alternative ingredient on broiler performance, nutrient digestibility, and cecal microbiota diversity. Poult. Sci. 100, 100853. doi: doi:10.1016/j.psj.2020.11.030
  55. Wang X., Liu Y., Zhao H.-H., Wu Y.-M., Liu C.-J., Duan G.-Y.. (2022). Effects of dietary ramie powder at various levels on the production performance, serum biochemical indices, antioxidative capacity, and intestinal development of laying hens. Front. Physiology Volume 12 - 2021 12. doi: doi:10.3389/fphys.2021.823734
  56. Weiss F. G., Scott M. L. (1979). Effects of dietary fiber, fat and total energy upon plasma cholesterol and other parameters in chickens. J. Nutr. 109, 693 – 701. doi: doi:10.1093/jn/109.4.693
  57. Wilson W. C., Slingerland M., Baijukya F. P., van Zanten H., Oosting S., Giller K. E. (2021). Integrating the soybean-maize-chicken value chains to attain nutritious diets in Tanzania. Food Secur. 13, 1595 – 1612. doi: doi:10.1007/s12571-021-01213-4
  58. Xing L., Wang M., He Q., Zhang H., Liang H., Zhou Q.. (2023). Differential subgenome expression underlies biomass accumulation in allotetraploid Pennisetum giganteum. BMC Biol. 21, 161. doi: doi:10.1186/s12915-023-01643-w
  59. Zhan J., Liu K., Yu H., Xing R., Liu S., Chen X. (2025). Bridging seaweed-derived polysaccharides and gut health: An integrated perspective on intestinal morphology, microbiota, and immunity. Process Biochem. 151, 146 – 151. doi: doi:10.1016/j.procbio.2025.02.009
  60. Zhang C., Hao E., Chen X., Huang C., Liu G., Chen H.. (2023). Dietary fiber level improve growth performance, nutrient digestibility, immune and intestinal morphology of broilers from day 22 to 42. Animals 13, 1227. doi: doi:10.3390/ani13071227
  61. Zhang M., Yang R., Huang Y.-Z., Lin Z.-X., Zheng X.-Y., Liu Q.-H.. (2025). Effects of Pennisetum giganteum on the growth performance and intestinal health of finishing Congjiang Xiang pigs. Acta Prataculturae Sin. 34, 171 – 188. doi: doi:10.11686/cyxb2024238
  62. Zhang L., Zeng Y.-T., Wang Y.-T., Li D.-J., Wang Y.-N., Wu Q. (2025). Metabolomics analysis of differences in muscle quality and flavor between Hetian chickens and fast-growing broilers. Chin. J. Anim. Nutr. 37, 5486 – 5500.
  63. Zitka O., Skalickova S., Gumulec J., Masarik M., Adam V., Hubalek J.. (2012). Redox status expressed as GSH:GSSG ratio as a marker for oxidative stress in paediatric tumour patients. Oncol. Lett. 4, 1247 – 1253. doi: doi:10.3892/ol.2012.931

Citation

Gu, X., et al. (2026). Effects of Cenchrus fungigraminus powder on growth performance, economic benefits, intestinal absorption, and liver antioxidant capacity in Hetian chickens. Frontiers in Animal Science, Volume 7. https://doi.org/
Received
Accepted
Published
Volume
7 - 2026

Copyright

Copyright © 2026 Gu, Lv, Yang, Cai, Wang, Jin and Gao.

License: https://creativecommons.org/licenses/by/4.0/

*Correspondence: Ling Jin; Yu-Yun Gao

Article metrics

Views
0
Downloads
0
Citations
0
Shares
0

Related articles

ReviewBenefits of tannin added to concentrate diets fed to ruminants and monogastric livestockJohn R. CaradusOriginal ResearchSunflower seed processing affects nutrient utilization and performance in feedlot ewe lambs fed high-concentrate diets with or without chitosanFlávia dos Santos Nunes, Bárbara Bianca Porto de Avelar Dias, José Esler de Freitas Júnior, Hérick Pachêco Rodrigues, Joyanne Mirelle de Sousa Ferreira, Alana Venâncio da Silva, João Pedro Souza Santana, Lígia Lins Souza, Stefanie Alvarenga Santos, Gleidson Giordano Pinto de Carvalho, José Augusto Gomes AzevêdoBrief Research ReportValidation of a computer-vision milking parlour monitoring systemFernando J. Guardado Servellón, David L. Renaud, Nolan Davies, Madyson Dailey, Kelsey L. Spence, Trevor J. DeVries, Rita Couto Serrenho