Detection of AMR and identification of Salmonella enterica in indigenous, broiler and layers poultry in some major markets of Morogoro Municipal, Tanzania

S almonella enterica is a major global cause of food-borne illness, with poultry products being a primary route of transmission to humans. The rise of antimicrobial-resistant strains in poultry significantly heightens public health risks, especially in low-and-middle income countries such as Tanzania. A cross-sectional study was carried out from January to July 2025 in three live-bird markets in Morogoro Municipality, namely Bigwa, Mawenzi, and Kingalu. Cloacal swabs were collected from broiler, layer, and indigenous chickens. Samples were processed using selective enrichment, standard bacteriological culture, and biochemical tests, with confirmation by VITEK-MS (bioMérieux), and PCR targeting the invA gene. Antimicrobial susceptibility was assessed using the Kirby-Bauer disk diffusion method following Clinical and Laboratory Standards Institute 2025 guidelines. Salmonella enterica was detected in 1% (3/300) of the samples, all from broiler chickens in Bigwa market. VITEK-MS identified all isolates as Salmonella enterica with confidence scores of 99.9%. PCR confirmed the invA gene in all three isolates, producing a 796 bp amplicon. Antimicrobial susceptibility testing showed 100% resistance to tetracycline and trimethoprim–sulfamethoxazole, 66.7% resistance to ampicillin and azithromycin, and 33.3% resistance to ciprofloxacin, while all isolates remained susceptible to ceftriaxone. All isolates (3/3, 100%) exhibited multidrug resistance. This study demonstrates the presence of multidrug-resistant Salmonella enterica in broiler chickens in Morogoro, Tanzania. Despite the limited number of isolates in this research, the detection of multidrug-resistant Salmonella enterica highlights a potential public health concern. Enhanced surveillance, responsible antimicrobial stewardship in poultry systems, and coordinated One Health interventions are recommended.

Salmonella enterica is an important global food-borne pathogen, with poultry meat serving as a major source of human infection (Brasileiro et al., 2025), which causes a substantial disease burden, contributing an estimated 1.028 million illnesses, 19,000 hospitalizations, and 400 deaths annually in the United States alone (Lamichhane et al., 2024). Most human salmonellosis cases result from consuming contaminated foods, including poultry meat, eggs, and fresh produce (Foley et al., 2011).

This bacterium exploits a wide range of animal reservoirs and persists in diverse environments, complicating its control (Brasileiro et al., 2025). More than 2,600 Salmonella serovars have been identified, most of which are associated with poultry production systems. These serovars cause two main disease forms: typhoidal salmonellosis, primarily due to S. pullorum and S. gallinarum, and non−typhoidal salmonellosis caused by numerous other serovars (Mkangara, 2023; Salah et al., 2025). While typhoidal infections tend to be host−restricted, non-typhoidal Salmonella can infect multiple species, including humans. The transmission of pathogens through animal source foods is further complicated by the spread of antimicrobial-resistant strains. Antimicrobial use in human and veterinary medicine exerts selective pressure that drives the emergence of resistant bacteria and reduces the effectiveness of available treatment options (Punchihewage-don et al., 2022). Evidence increasingly shows that antimicrobial resistance in human Salmonella infections is linked to antimicrobial use in food animals, contributing to increased morbidity, mortality, and associated health care costs (Thai et al., 2012).

In Tanzania, rapid economic growth and an expanding middle class have increased demand for poultry products. While this trend benefits the poultry sector, it has also intensified production, contributing to more frequent disease outbreaks, including salmonellosis. To manage these challenges, farmers commonly use antibiotics not only for treatment but also for prophylaxis and growth promotion (Mwambene et al., 2025).

Therefore, this study was conducted to investigate the occurrence of Salmonella enterica and the antimicrobial resistance pattern of isolates recovered from poultry sold in Morogoro Municipal markets, Tanzania. The generated evidence on the contribution of intensified poultry production and antibiotics use to the emergence of antimicrobial-resistant Salmonella enterica will inform policy on prudent antibiotics use in poultry, strengthening antimicrobial resistance surveillance, and contribute to public health strategies for controlling food-borne salmonellosis.

Study area

The study was conducted in Morogoro Municipality in eastern Tanzania. According to the 2019/2020 National Sample Census of Agriculture, the country maintains approximately 87.7 million chickens, comprising 17.9% broilers, 23% layers, and 59.1% indigenous birds, with 3.6 million (4.4%) located in the Morogoro region (Tanzania Ministry of Agriculture, 2021). Morogoro is one of the important poultry-producing regions in Tanzania, supplying both commercial markets and household consumption.

Sample size determination

The sample size for this study was estimated using Cochran’s formula for proportions (Cochran, 1963),

Where:

n = sample size.

p = expected prevalence.

d = desired level of precision (5%).

With 95% confidence level (Z = 1.96), an expected proportion of 0.5, and a margin of error of 0.05, the calculated minimum sample size was 385. However, due to practical constraints encountered during field sampling, including logistical limitations and accessibility of birds in live-bird markets, a total of 300 samples were collected. With this sample size and the same confidence level and assumed proportion, the corresponding margin of error is approximately 5.6%. The final data set comprised 100 indigenous chickens, 100 layers, and 100 broilers, providing adequate statistical power for descriptive epidemiological comparisons among the different poultry production types while remaining feasible for field sampling.

Study design and sampling method

A cross-sectional study was conducted in three major open live-bird markets in Morogoro Municipality, namely Kingalu, Bigwa, and Mawenzi, between Jan and July 2025. The markets were chosen based on their high poultry trading activity, which made them ideal sites for assessing potential public health risks associated with antimicrobial resistance.

Sample collection method

A sterile swab was inserted into the chicken cloaca to obtain a sample. Cloacal swabbing was selected because it reliably reflects persistent intestinal colonization by enteric pathogens such as Salmonella enterica (Islam et al., 2016). Each swab was placed into a sterile tube containing 10 ml of Stuart’s transport medium (Oxoid Ltd., UK) and stored in a cool box at 4°C. Samples were then transported to the Microbiology Laboratory, Department of Microbiology, Parasitology and Biotechnology, Sokoine University of Agriculture, for microbiological analysis.

Isolation and biochemical characterization

Samples were first pre-enriched in nutrient broth and subsequently inoculated into Selenite F broth (TM Media, India), a selective medium that suppresses Gram-positive bacteria and most Gram-negative species other than Salmonella and Shigella. Cultures were streaked onto Salmonella-Shigella (SS) agar (Oxoid Ltd., UK) and incubated at 37 °C for 18-24 h. Typical Salmonella colonies appeared colorless with black centers due to H 2 S production. Representative colonies were sub−cultured onto Xylose Lysine Deoxycholate (XLD) agar (HiMedia, India) to obtain pure isolates, where Salmonella produced black, convex colonies. Presumptive Salmonella colonies (red with black centers on XLD) were confirmed using standard biochemical assays, including Sulfur Indole Motility (SIM) and the indole, methyl red, Voges-Proskauer, and citrate utilization (IMViC) tests (HiMedia, India).

VITEK- MS identification of bacterial isolates

Bacterial isolates were sub−cultured on Xylose Lysine Deoxycholate (XLD) agar (HiMedia, India) and incubated at 35–37 °C for 18–24 h to obtain fresh, well isolated colonies. Species identification was performed by matrix-assisted laser desorption/ionization time of flight mass spectrometry using the VITEK ® MS system (bioMérieux, France).

A single colony from each plate was selected for VITEK-MS analysis. Each colony was transferred onto an individual spot on a VITEK target plate, air−dried, and overlaid with 1 µL of α−cyano−4−hydroxycinnamic acid (HCCA) matrix. After complete drying at room temperature, the target plate was loaded into the VITEK-MS (bioMérieux) system for protein profiling. Mass spectra generated for each isolate were automatically matched against the reference database to determine species−level identity. Identifications with confidence scores ≥ 85% were accepted. Pathogenicity classifications provided by the VITEK−MS database (e.g., “Critical”) were used to assess clinical relevance. Escherichia coli ATCC 8739 was included as a quality−control strain to verify instrument performance and identification accuracy.

PCR confirmation of Salmonella enterica

Presumptive Salmonella colonies were sub−cultured on nutrient agar and incubated at 37°C for 24 h. Genomic DNA was extracted using the boiling method. Briefly, colonies were suspended in nuclease-free water, heated at 95°C for 10 min, chilled at −21°C for 5 min, and the heat-freeze cycle was repeated twice. Lysates were centrifuged at 12,000 rpm for 1 min, and the supernatant was transferred to sterile PCR tubes. DNA concentration and purity were assessed using a Nanodrop-spectrophotometer (Biochrom Ltd., England).

PCR reactions were carried out in a ProFlex ™ 3×32-Well PCR System (Thermo Fisher Scientific, USA) thermocycler. Amplification reactions constituted a final volume of 25 µl which contained 12.5 µl premix of Quick-Load ® oneTaq, 0.5 µl each of forward and reverse primers were used (Macrogen Inc., South Korea) https://www.macrogen.com, 6.5 µl nuclease-free water, and 5 µl DNA template. Species−specific detection targeted the invA gene, 796 bp, using primers described by (Mwambene et al., 2025). forward 5′−CGGTGGTTTTAAGCGTACTCTT−3′ and reverse 3′−CGAATATGCTCCACAAGGTTAA−5′.

Thermal cycling conditions included initial denaturation at 95°C for 5 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; followed by a final extension at 72°C for 10 min.

Agarose gel electrophoresis was performed by using HU10 mini-plus (10cm) horizontal gel electrophoresis unit (Scie-Plas Camlab, UK) together with the nanoPAC-300 Electrophoresis Power Supply (SLS Flowgen, UK). The amplification/PCR products along with Quick-Load 100bp DNA ladder (New England Biolabs, UK) were resolved on 1.5% agarose gel stained with ethidium bromide, and the presence of a 796 bp band confirmed invA amplification. The PCR products were visualized under UV light using a trans- illumination machine (T2201 SIGMA Chemical Company, USA).

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing of Salmonella isolates was performed using the Kirby–Bauer disk diffusion method on Mueller-Hinton agar (Oxoid Ltd., UK) in accordance with CLSI (2025) guidelines. A single pure colony from XLD agar was suspended in 2 ml of sterile normal saline and adjusted to a 0.5 McFarland turbidity standard. A sterile swab was immersed in the suspension and used to uniformly inoculate the entire surface of MHA plates by streaking in three directions. Seven antibiotic discs of defined concentrations (Table 1) were placed on the inoculated plates, which were then incubated at 37°C for 24 h.

Data analysis

Data was analyzed using descriptive statistics. The occurrence of Salmonella enterica among the collected poultry samples was summarized as counts and percentages. Antimicrobial susceptibility results for the recovered isolates were interpreted according to CLSI 2025 guidelines, and multidrug resistance was defined as resistance to three or more classes of antimicrobial agents.

Salmonella enterica isolation

Red colonies with a central black spot on XLD agar were considered presumptive salmonella (Figure 1). Only 1% (3/300) of cloacal swab isolates from Bigwa Market were confirmed positive, while no Salmonella was isolated from Mawenzi and Kingalu markets. Primary identification relied on characteristic cultural and morphological features supported by standard biochemical tests such as IMVIC and SIM test.

VITEK- mass spectrometry analysis

VITEK mass spectrometry identified bacterial species across the analyzed sample positions. Salmonella enterica was detected in three positions (B1, E1, and F3) with confidence scores of 99.9%. The organism was marked with Pathogenicity: Critical, underscoring its clinical and public health relevance, as summarized in Table 2.

PCR detection of Salmonella enterica

PCR detection targeting the invA gene confirmed the presence of Salmonella enterica in all three culture positive samples (3/300). Each isolate produced the expected amplicon of 796 bp, verifying their genetic identity. The amplification pattern is illustrated in Figure 2.

Antimicrobial susceptibility profiles

All three Salmonella isolates from Bigwa Market exhibited multidrug resistance. Resistance to tetracycline and trimethoprim–sulfamethoxazole was observed in all isolates (3/3, 100%), while resistance to ampicillin and azithromycin was detected in two isolates each (2/3, 66.7%). One isolate (1/3, 33.3%) showed resistance to ciprofloxacin. All isolates were fully susceptible to ceftriaxone (3/3, 100%), as shown in Figure 3 and Table 3.

A small proportion (1%) of broiler chicken samples tested positive for Salmonella enteric a, and no isolates were detected in layers or indigenous chickens, indicating a relatively low burden compared to previous reports from Tanzania and other regions. Earlier studies in Dar es Salaam documented higher prevalence levels, including 8% carriage of non−typhoidal Salmonella (NTS) among healthy broilers, layers, and backyard chickens (Kimera et al., 2021), and 24.6% presumptive Salmonella isolates from poultry and market environments (Mwambene et al., 2025). These discrepancies highlight the substantial heterogeneity in Salmonella occurrence across production systems and geographic settings.

Antimicrobial resistance patterns observed in this study is constrained by the very small number of isolates (n = 3). The results indicate reduced susceptibility of Salmonella enterica to several commonly used antibiotics, including ampicillin, tetracycline, and trimethoprim–sulfamethoxazole. Although based on a limited number of isolates, these findings are consistent with previously reported resistance trends in poultry-associated Salmonella in Tanzania and comparable settings. From an antimicrobial resistance perspective, such patterns may reflect ongoing selective pressure driven by antimicrobial use in poultry production systems. However, given the small number of confirmed isolates, these results should be interpreted as indicative rather than representative of the broader resistance situation (Mwambene et al., 2025).

Globally, prevalence varies widely, with studies in East Africa reporting a prevalence of 3.6% in Kenya (Nyabundi et al., 2017), 7-18% in Ethiopia, depending on production system (G. Tadesse and Gebremedhin, 2015), and up to 20-30% in intensively reared poultry in Brazil (Paião et al., 2013). Such variation is commonly attributed to differences in sampling strategies, flock age, biosecurity levels, antimicrobial use practices, and diagnostic sensitivity. Molecular assays targeting virulence genes such as invA typically yield higher detection rates than culture alone, particularly in healthy birds that shed Salmonella intermittently (Paião et al., 2013).

The absence of Salmonella in indigenous and layer chickens in this study may suggest differences in production systems; however, given the small number of isolates and the descriptive nature of the study, these observations should be interpreted cautiously and not as definitive evidence of reduced risk. Indigenous chickens in Tanzania are predominantly raised under extensive, low−input systems with minimal antimicrobial exposure, reducing selective pressure for both colonization and resistance (Munuo et al., 2022). Layer farms, although intensive, often maintain stricter hygiene, longer production cycles, and more structured vaccination and management programs, which may limit pathogen introduction and persistence (Chota et al., 2021). In contrast, broiler production is characterized by rapid turnover, high stocking densities, and frequent antimicrobial use for prophylaxis and growth promotion conditions that favor Salmonella colonization and the emergence of resistant strains (Munuo et al., 2022).

The use of VITEK-MS in this study provided rapid and reliable species-level identification, consistent with its documented performance in clinical and veterinary microbiology (Singhal et al., 2015). Confirmation of Salmonella enterica by both VITEK-MS and invA gene amplification strengthens the validity of the findings and aligns with previous work demonstrating the robustness of invA as a molecular marker for Salmonella detection (Kim et al., 2022).

The epidemiological context of Bigwa market likely contributed to the observed Salmonella presence. As a major poultry trading hub in Morogoro Municipality, Bigwa receives broilers from multiple commercial and peri−urban farms with variable biosecurity and antimicrobial use practices. High bird turnover, mixing flocks from different sources, overcrowding, and inadequate sanitation create ideal conditions for horizontal transmission of Salmonella and dissemination of antimicrobial-resistant strains (Mwambene et al., 2025). In contrast, Mawenzi and Kingalu markets source more birds from backyard or small−scale producers with shorter supply chains and lower antimicrobial exposure, which may explain the absence of Salmonella isolation in those markets.

The detection of multidrug resistance in all isolates (n=3) represents a preliminary observation due to limited sample size. Nevertheless, resistance to commonly used antimicrobials such as ampicillin, tetracycline, and sulfamethoxazole-trimethoprim in poultry-associated Salmonella reflects widespread and often unregulated antimicrobial use in poultry production (Munuo et al., 2022). Similar MDR patterns have been documented across sub-Saharan Africa, where resistance to first-line antimicrobials frequently exceeds 50% (B. T. Tadesse et al., 2017). Globally, MDR Salmonella is recognized as a major public health threat, associated with prolonged illness, increased hospitalization, and reduced treatment options (Kimera et al., 2021).

The detection of multidrug resistant and pathogenic Salmonella enterica in broilers from a major urban market indicates a potential zoonotic risk. This may facilitate transmission through handling, slaughter, and consumption of contaminated poultry products. However, interpretation should remain cautious given the limited number of isolates. Given the central role of poultry as an affordable protein source in Tanzania, these findings underscore the urgent need for strengthened One Health interventions. Priorities include improved farm−level biosecurity, regulated antimicrobial use, enhanced surveillance across the poultry value chain, and targeted hygiene and food safety education for traders and consumers. Integrating animal, human, and environmental health perspectives is essential to mitigate the spread of Salmonella and curb the growing threat of antimicrobial resistance.

This study identified a low occurrence (1%) of Salmonella enterica in poultry sampled from Morogoro municipal markets, with all isolates recovered from broiler chickens in Bigwa market. Despite the limited number of isolates, the detection of multidrug resistant Salmonella enterica highlights a potential public health concern. However, due to the small sample size and cross-sectional design, these findings should be interpreted as preliminary. Strengthening biosecurity, improving antimicrobial stewardship, and expanding surveillance across the poultry value chain are essential. A coordinated One Health approach remains critical for mitigating the spread of antimicrobial resistant pathogens.

This study has several limitations that should be considered when interpreting our findings. First, sampling was confined to only three markets within Morogoro Municipality, which may limit the generalization of the results to other market settings and regions of Tanzania with different poultry production systems, supply chains, and biosecurity practices.

Second, the number of Salmonella enterica isolates recovered from our study was small, hence reducing the statistical power to compare prevalence and antimicrobial resistance patterns across production types and market environments. Future studies should incorporate larger sample sizes and broader geographic sampling to improve representativeness.

Third, the study relied on culture-based methods for initial detection, which are less sensitive than enrichment. PCR approaches and may underestimate true prevalence, particularly in birds shedding Salmonella intermittently or at low levels. Additionally, the cross-sectional design employed in this study captured only a single time point and did not account for seasonal or temporal variations in pathogen circulation, antimicrobial use, or market-level contamination.

Fourth, the sampling was conducted at markets rather than at the farm level where the chickens were originating, limiting the ability to link antimicrobial resistance patterns to specific farm-level practices, including antimicrobial use, vaccination, or biosecurity measures. The absence of environmental samplings, like transport crates or market waste, may have also restricted our understanding of potential contamination pathways within the poultry value chain in this area.

Furthermore, the study did not include serotyping or genomic characterization of isolates, which would have provided deeper insights into circulating serovars, virulence determinants, and resistance gene profiles. The antimicrobial susceptibility panel, while focused on commonly used drugs in poultry production, did not encompass the full range of antimicrobials critical for human medicine, limiting the scope of resistance assessment that would inform public health policy.

Finally, there is a potential sampling bias because birds presented for sale at urban markets may not fully represent the diversity of production systems in the region, particularly the predominance of broilers relative to indigenous chickens.

These limitations highlight the need for broader, longitudinal, and genomics-informed surveillance to more comprehensively characterize Salmonella epidemiology and antimicrobial resistance in Tanzanian poultry production systems.