Skip to content
Frontiers
Search

Original Research

Frontiers in Tropical Diseases ·

Volume 7 - 2026 | https://doi.org/10.3389/fitd.2026.1918848

Comparative assessment of three methods (Chelex-based method, commercial kit, and CTAB-based method) for extracting DNA from Whatman filter paper on which urine samples were filtered and stored for molecular diagnosis of urinary schistosomiasis

  • Estelle Mezajou Mewamba1*corresponding author
  • Ivana Morgane Rachel Banga Diengue1
  • Darelle Bethanie Motia1
  • Edmond Loic Tekeu Mengoue1
  • Rostand Tatang Atiokeng2
  • Auvaker Arnol Zebaze Tiofack1
  • Pythagore Soubgwi Fogue1
  • Gustave Simo1
  1. 1Molecular Parasitology and Entomology Unit, Department of Biochemistry, Faculty of Science, University of Dschang, Dschang, Cameroon
  2. 2Research Unit of Biology and Applied Ecology, Department of Animal Biology, Faculty of Science, University of Dschang, Dschang, Cameroon
Article metrics0 viewsView details
PDFCiteMetrics

Abstract

Storage of urine samples and the need for DNA extract free from PCR inhibitors remains serious challenges for the molecular diagnosis of urinary schistosomiasis. This study was designed to address these challenges by assessing the efficiency of three DNA extraction methods using Whatman filter papers on which urine samples were filtered and stored for molecular diagnosis of urinary schistosomiasis. Urine samples were collected from school-aged children in the Matta health area and analyzed using the urine filtration test. For this study, 120 urine samples with S. haematobium eggs and 54 without eggs were filtered through punched Whatman filter papers and stored for up to 20 weeks. DNA was extracted from these filter papers at different time points using three DNA extraction methods. The performance of these extraction methods and the capacity of the filter papers to store S. haematobium DNA for several weeks were assessed by amplifying a specific fragment of S. haematobium. All DNA extracts obtained using the Chelex-based method yielded successful amplification up to 12 weeks of urine preservation on Whatman filter papers, whereas the amplification rate for the cetyltrimethylammonium bromide (CTAB)-based method decreased over time from 99.2% to 96.7%. When comparing amplification rates according to storage time, the amplification rate of extracts obtained using the Chelex-based method was significantly higher than that of extracts obtained using the other extraction methods after 12 weeks (P = 0.0007) and 20 weeks (P < 0.0001) of urine preservation on Whatman filter papers. Using the Chelex-based method, the sensitivity and specificity of PCR ranged from 99.2% to 100% and from 77.8% to 83.3%, respectively. This study demonstrated the performance of the Chelex-based method for extracting S. haematobium DNA preserved on these papers. The extraction cost for the Chelex-based method (€0.24) appeared reliable and was at least 2 times more cost-effective than the CTAB-based method and the commercial kit. Combining this method with urine storage on Whatman filter paper could improve the diagnosis, surveillance, and elimination monitoring of urinary schistosomiasis.

Keywords

1 Introduction

Schistosomiasis is one of the most common neglected tropical diseases affecting poor and rural communities that lack adequate personal and environmental hygiene, have limited access to clean water, and experience poor socioeconomic conditions (1, 2). Approximately 700 million people are at risk of infection and about 229 million are currently infected worldwide (3, 4). Among blood-dwelling flukes of the genus Schistosoma that cause this disease, Schistosoma haematobium (S. haematobium) is responsible for urinary schistosomiasis, which affects approximately 112 million people in Africa (5–8).

Although several control strategies, including preventive chemotherapy (PC), water sanitation and hygiene (WASH), snail control, and the dissemination of information, education, and communication, have been developed to control schistosomiasis (9), the main control strategy recommended by the World Health Organization (WHO) is preventive chemotherapy (PC), in which praziquantel is administered on a large scale to school-aged children who carry the heaviest worm burdens and thus experience a high degree of morbidity (10–12). With this PC, the prevalence and infection intensities of schistosomiasis have considerably decreased, and currently, schistosomiasis is included in the WHO 2021–2030 road map of Neglected Tropical Diseases, which targets its elimination as a public health problem by 2030 (2). As the prevalence decreases and elimination approaches, it becomes essential to develop sensitive, specific, and reliable diagnostic tools that will enable validation of disease elimination, monitoring and evaluation of control programs, and post-elimination surveillance. Such tools will also enable accurate determination of disease prevalence and hence the current epidemiological situation of the disease in different epidemiological settings.

The urine filtration test that relies on the microscopic observation of schistosome eggs is recognized as the gold standard method for diagnosing S. haematobium infections (13, 14). This parasitological method has been reported to have low sensitivity, especially in individuals with low-intensity schistosome infections (12, 14–17). In most epidemiological settings subjected to PC, its use may lead to underestimation of the prevalence and intensity of schistosome infections (18). The point-of-care circulating cathodic antigen test (POC-CCA), which was developed to overcome the low sensitivity of parasitological methods and detects schistosome circulating cathodic antigen (CCA), is reliable for diagnosing S. mansoni infections even when the worms have not yet started laying eggs. However, this POC-CCA was reported to be less sensitive for urinary schistosomiasis (19, 20). As highlighted in the 2021–2030 Neglected Tropical Diseases Road map, developing reliable and accurate diagnostic tools for screening and surveillance of urinary schistosomiasis remains not only a desirable goal to achieve, but also a crucial area for action to ensure that public health targets for 2030 will be achieved (2, 21).

Although molecular tools have demonstrated their utility in detecting species-specific parasite DNA, their implementation on urine samples may be threatened by several factors, including the storage of biological samples under field conditions, the presence of DNA polymerase inhibitors, and the costs associated with DNA purification. As a complex biological sample, urine contains PCR inhibitors such as urea, crystals, nitrites, and hemoglobin that can significantly hinder DNA amplification and affect the performance of nucleic acid amplification (18, 22–24). Various DNA extraction methods, including commercial kits (25–31), phenol/chloroform extraction, and silica gel extraction (32, 33), have been proposed to extract schistosome DNA from urine samples. Widely used to extract schistosome DNA, commercial kits are costly, thus limiting their large-scale use for molecular monitoring of schistosomiasis in low- and middle-income countries. Compared to commercial kits, the performance of other DNA extraction methods, including phenol/chloroform and silica gel extraction methods (32, 33), that have been used to extract DNA for molecular diagnosis of urinary schistosomiasis (25, 27, 28, 34), remains unknown. Assessing the costs and performance of other laboratory-developed DNA extraction methods reported to be cost-effective, easy to perform, and able to yield DNA free of PCR inhibitors is critical not only for improving the molecular diagnosis of schistosomiasis in resource-limited settings, but also for supporting schistosomiasis control and elimination and ensuring post-elimination surveillance. Although the cetyltrimethylammonium bromide (CTAB)-based method was reported to be reliable and cost-effective for extracting soil-transmitted helminth DNA from stool samples and other biological samples stored on Whatman filter papers for molecular diagnosis of soil-transmitted helminthiasis, its performance on urine samples remains unknown (25, 27, 28, 35–40).

Although Whatman filter paper has been used to store urine samples for molecular detection of schistosome infections (25, 27, 34), its epidemiological value and its capacity for long-term storage of urine samples for molecular diagnosis of urinary schistosomiasis have not been addressed. Moreover, in this elimination context, in which thousands of samples must be analyzed not only to validate schistosomiasis elimination but also to monitor and evaluate control programs, and ensure post-elimination surveillance, the storage of urine samples under field conditions for the molecular diagnosis of urinary schistosomiasis is critical. This study was designed to fill these gaps by assessing three methods of extracting S. haematobium DNA from urine samples stored on Whatman filter papers for several months for the molecular detection of S. haematobium infections.

2 Materials and methods

2.1 Ethical considerations

The protocol of this study was approved by the National Ethics Committee for research on human health of the Ministry of Public Health of Cameroon with the authorization number No. 2023/08/1568/CE/CNERSH/SP. This protocol was also approved by the review board of the Molecular Parasitology and Entomology Subunit of the Department of Biochemistry of the Faculty of Science of the University of Dschang. Before field surveys, approval was also obtained from administrative and traditional authorities, school inspectors, directors, and teachers. A signed informed consent form was obtained from a parent or guardian of each participating child. In addition, an assent form was obtained from children aged 12–15 years, as described by Mewamba et al. (41). During the analyses, the data for each individual were anonymized. Children found with S. haematobium eggs were treated with praziquantel (40 mg/kg body weight) according to WHO recommendations (42).

2.2 Study area

This study was conducted in the Matta health area of the Magba Sub-division in the West region of Cameroon (41). This locality has an equatorial climate, and its vegetation consists of dense savannah that is often muddy (43). This health area has been recognized as endemic for urinary schistosomiasis for more than 10 years (43–46) and for animal schistosomiasis (47). In this health area, mass drug administration (MDA) of praziquantel to school-aged children is the main control method that has been used to control schistosomiasis for several decades (48). Samples used in this study were collected from four primary schools in the Matta health area, namely, the public school (PS) of Matta barrage, the PS of Matta village, the PS of Mambonkor bord, and the PS of Mambonkor village (41).

2.3 Sample collection and parasitological examination

Approximately 50 mL of urine was collected between 9:00 am and 1:00 pm from each school-aged child attending the four public primary schools of the Matta health area (41). These samples were transported to the nearest health center (Centre de santé intégré de Matta), where the urine samples were examined for schistosome infections using the urine filtration test (UF), as described by Peters et al. (49). For this UF, each urine sample was homogenized, and thereafter, 10 mL of urine was filtered using the urine filtration kit (Lot No. M/310322, batch No. 64720, Sterlitech Corporation, USA), as described by Mewamba et al. (41). The filters were microscopically examined to search for schistosome eggs. Schistosome infections were recorded, and the infection intensities were determined by counting the number of eggs in each urine sample and expressing the results as eggs per 10 mL of urine.

2.4 Punching filter paper for urine sample storage

To assess the efficacy of Whatman filter papers for storing urine samples for molecular detection of schistosome infections, urine samples were filtered through punched discs of these papers. Using a manual puncher developed in this study (Figure 1), Whatman filter paper (Whatman No. 3 filter paper disc, Whatman International, Maidstone, England) was punched into discs (Figure 1). Each punched disc was 13 mm in diameter, identical to the diameter of the polycarbonate screen membrane filters (13 mm in diameter) manufactured by Sterlitech and used for the urine filtration tests.

Whatman filter paper puncher and punched filter paper. **(A)** Manual puncher; **(B)** disc of Whatman No. 3 filter paper; and **(C)** small punched discs of filter paper with the same dimensions as Sterlitech polycarbonate screen membrane filters.
Figure 1. Whatman filter paper puncher and punched filter paper. (A) Manual puncher; (B) disc of Whatman No. 3 filter paper; and (C) small punched discs of filter paper with the same dimensions as Sterlitech polycarbonate screen membrane filters.

2.5 Filtering of school-aged children’s urine samples through punched discs of Whatman filter papers

For this study, urine samples with and without schistosome eggs were directly filtered using a syringe through punched discs (13 mm in diameter) of Whatman filter paper to concentrate S. haematobium eggs or DNA. Briefly, each punched disc of Whatman filter paper was introduced into a 10 mL syringe. Thereafter, 10 mL of urine from each child was placed in the syringe and then filtered. The punched discs of filter paper were removed from the syringe and air-dried under a fly-proof net. Thereafter, and before their transportation to the laboratory, the punched discs of filter paper were individually packed in small plastic bags containing a desiccant (Figure 2A). Each plastic bag was labeled with the sample identification (ID).

Storage of Whatman filter paper. **(A)** Whatman filter paper discs stored in a Ziplock plastic bag; **(B)** Whatman filter paper disc in a plastic bag and stored in a siever; and **(C)** Whatman filter paper disc cut into two equal parts using a razor blade.
Figure 2. Storage of Whatman filter paper. (A) Whatman filter paper discs stored in a Ziplock plastic bag; (B) Whatman filter paper disc in a plastic bag and stored in a siever; and (C) Whatman filter paper disc cut into two equal parts using a razor blade.

2.6 Storage of punched discs of Whatman filter papers on which urine samples were filtered

In the laboratory, the plastic bags containing the punched discs of Whatman paper on which urine samples were filtered were stored in a siever at room temperature for up to 20 weeks (Figure 2B).

2.7 DNA extraction from punched discs of Whatman filter paper on which urine samples were filtered

For this extraction, punched discs (13 mm in diameter) of Whatman filter paper on which urine samples were directly filtered and then stored for 1, 3, 12, and 20 weeks were used. Before beginning DNA extraction, each punched disc (13 mm in diameter) of Whatman filter paper was divided into two equal parts using a sterile razor blade (Figure 2C). Thereafter, S. haematobium DNA was extracted from half-punched discs of Whatman filter paper that had been stored for 1, 3, 12, and 20 weeks. This extraction was performed using the Chelex-based method, the CTAB-based method, and a commercial kit, namely, the QuickDNA™ Miniprep Plus Kit (Zymo Research). While the Chelex based-method uses Chelex® 100 resin as the extraction matrix that binds polyvalent metal ions to allow rapid DNA extraction without the need for organic solvents, the CTAB-based method uses CTAB as the principal extraction reagent that lyses cell membranes and removes polysaccharides and other contaminants. These two DNA extraction methods yield DNA extracts that are free of or contain few DNA polymerase inhibitors.

During DNA extraction using the different methods, negative biological controls, consisting of punched discs of Whatman paper without urine samples, were used and treated alongside the Whatman papers on which urine samples were filtered. Extracts from these controls were used as additional controls during PCR.

Samples selected for DNA extraction were those for which at least 6 punched discs of Whatman paper were available. This provided 12 halves punched discs of Whatman filter paper, which were required for the three different DNA extraction methods and the four time points, namely, 1, 3, 12, and 20 weeks of storage.

2.7.1 Extraction of Schistosoma haematobium DNA using the Chelex-based method

Briefly, one half of a punched disc of Whatman filter paper on which a urine sample was filtered was introduced into a sterile labeled 1.5 mL tube. Thereafter, 300 µL of 5% Chelex solution, previously maintained under cold magnetic stirring, was added to each microtube. The contents of each microtube were manually ground with a pestle until a homogeneous mixture was obtained. Each tube was vigorously homogenized for 10 min before sequential incubation in a water bath at 56 °C for 30 min and then at 98 °C for 10 min. The tubes were centrifuged at 14,000 rpm for 5 min, and thereafter, 150 µL of the supernatant (DNA extract) was transferred into a new sterile 1.5 mL tube. The DNA extracts were stored at −20 °C for further molecular analysis.

2.7.2 Extraction of S. haematobium DNA using the CTAB-based method

The DNA extraction using the CTAB-based method was performed as described by Kamdem et al. (35, 36). One half of a punched disc of Whatman filter paper on which a urine sample was previously filtered was placed into a labeled sterile 1.5 mL tube. In each of these tubes, 700 µL of CTAB solution (5% CTAB, 1 M Tris [pH 8], 0.5 M EDTA [pH 8], 5 M NaCl, and 0.2% β-mercaptoethanol) was added, and the contents of each tube were ground using a pestle until a homogeneous mixture was obtained. The tubes were incubated at 60 °C for 30 min before the addition of 700 µL of chloroform/isoamyl alcohol (24:1, v/v). Thereafter, the tubes were slowly homogenized by inversion for 15 min, followed by centrifugation at 8,000 rpm for 15 min. After transferring about 450 µL of the upper aqueous phase containing nucleic acids into a new sterile 1.5 mL tube, an equivalent volume of isopropanol was added before slow homogenization by inverting the tube for 5 min. This was followed by another incubation at −20 °C for 24 h. After this incubation, each microtube was centrifuged at 13,000 rpm for 15 min, and the supernatant was discarded. The DNA pellet was washed twice with 1 mL of 70% cold ethanol before another centrifugation at 13,000 rpm for 15 min. The tubes containing the DNA pellet were left open to air-dry overnight at room temperature. The resulting DNA pellet was resuspended in 80 µL of sterile water and then stored at −4 °C for 24 h and later at −20 °C for molecular analysis.

2.7.3 Extraction of Schistosoma haematobium DNA using a commercial kit (Zymo Research)

For the extraction using the Quick-DNA Miniprep Plus” kit (Cat. No. D0469, Lot.No: 206083, Zymo Research, California, United States), one half of a punched disc (13 mm in diameter) of Whatman filter paper on which a urine sample was filtered was placed into a labeled sterile 1.5 mL microtube. After adding 200 µL of sterile water, the contents of each microtube were ground using a pestle until a homogeneous mixture was obtained. The tubes were incubated at 95 °C for 10 min and then overnight at 25 °C with a rotation at 150 rpm. After centrifuging the tubes at 8,000 rpm for 1 min, 200 µL of the supernatant was transferred into a new sterile 1.5 mL microtube. DNA extraction was then performed according to the manufacturer’s instructions. The resulting DNA extracts were stored at −20 °C for molecular analysis.

2.8 Assessment of DNA extraction methods for the molecular detection of S. haematobium and the capacity of Whatman filter paper to store urine samples for molecular diagnosis of S. haematobium infections

The assessment of DNA extraction methods for detecting S. haematobium infections was performed by amplifying a cytochrome oxidase 1 (COX1) DNA fragment of S. haematobium in DNA extracts from 174 urine samples, including 120 with and 54 without S. haematobium eggs, as revealed by the urine filtration test. DNA extracts from punched discs of Whatman filter paper on which urine samples were filtered and that were stored for 1, 3, 12, and 20 weeks were used. During this assessment, DNA extracts obtained using the Chelex-based method, CTAB-based method, and the Zymo Research commercial kit were used. The amplification and detection of S. haematobium infections were performed by amplifying the Cox1 DNA fragment of S. haematobium using ShF and CR primers (ShF: 5’AGTCGTGTCGATTTTAAGAC3’/CR: 5’CCAACCATAAACATATGATG3’), as described by Kato-Hayashi et al. (26).

The amplification reaction was performed in a final volume of 15 µL containing 1× PCR buffer, 1.5 mM of MgCl2, 10 pmol of each primer, 200 µM of dNTPs, 0.3U of Q5 high-fidelity polymerase, 3 µL of Q5 GC Enhancer, and 5 µL of template DNA. For each series of PCR reactions, negative and positive controls were used. In positive controls, DNA extracts from S. haematobium were used as templates. Two negative controls were used: in one, nuclease-free water was used in place of the DNA template, while in the other, extracts from the negative DNA extraction control were used as the DNA template. The amplification program contained a denaturing step at 98 °C for 5 min followed by 35 amplification cycles. Each of these cycles comprised a denaturation step at 98 °C for 3 min, an annealing step at 58 °C for 45 s, and an extension step at 72 °C for 1 min. A final extension step was performed at 72 °C for 7 min.

PCR products were visualized by electrophoresis on a 1.5% agarose gel stained with ethidium bromide. The gel was visualized under UV light and then photographed. Samples showing DNA fragments of 365 bp were considered to contain S. haematobium DNA. All samples for which no amplification was obtained following the initial analysis were retested in independent PCR assays to confirm their amplification status and minimize the likelihood of false-negative results. In addition, some samples that remained negative were retested to assess the presence of PCR inhibitors. The remaining DNA extracts from these samples were spiked with DNA from a positive sample and then reamplified. After this reamplification, the presence of DNA fragments of 365 bp enabled the exclusion of DNA polymerase inhibitors in these samples.

For this study, the extraction performance was assessed based on successful PCR amplification rather than quantitative DNA yield.

The assessment of the capacity of Whatman filter paper to store urine samples for molecular diagnosis of S. haematobium infections was performed on some urine samples without schistosome eggs and on all urine samples in which the urine filtration test revealed S. haematobium eggs. For this assessment, S. haematobium DNA was detected in DNA extracts from punched discs of Whatman filter paper on which urine samples were filtered and stored for 1, 3, 12, and 20 weeks. This was done by amplifying cytochrome oxidase (COX1) 1 DNA fragments of S. haematobium as described above.

2.9 Assessment of DNA extraction costs for the Chelex-based method, the CTAB-based method, and commercial kits

To evaluate the cost of DNA extraction using the Chelex-based method and the CTAB-based method, all reagents and consumables used in the extraction process were listed, and their costs were determined according to prices found on the website of Sigma-Aldrich. Based on the quantity (mass, volume, or number) of each reagent and consumable purchased, the amount required for each DNA extraction and its corresponding cost were determined. The cost of DNA extraction for each urine sample was calculated by summing the cost of each reagent and consumable used in the extraction process. In addition to the costs of DNA extraction using the Chelex-based method and the CTAB-based method, the prices of some commercial kits were obtained from the websites of Zymo Research, Qiagen, Norgen Biotek, and Thermo Scientific. For each kit, the cost of DNA extraction for one urine sample was estimated by dividing the price of the commercial kit by the number of samples that could be extracted.

2.10 Statistical analysis

The chi-square test in R 4.2.0 software (“Vigorous Calisthenics”) was used to compare the number of samples amplified by different DNA extraction methods (Chelex-based method, CTAB-based method, and commercial kit) and among the urine-storage time points on Whatman filter paper (3 weeks, 12 weeks, and 20 weeks). The positive and negative predictive values (PPV and NPV), sensitivity, and specificity were calculated for each DNA extraction method using the online software Medcalc 12.4.0 (accessed 20 June 2025). For the long-term preservation of S. haematobium DNA on Whatman filter paper, the sensitivity, specificity, NPV and PPV were determined only after 12 and 20 weeks of urine storage on Whatman filter papers. The urine filtration test was used as the reference method to evaluate the diagnostic performance of the molecular tool using the different extraction methods after 12 and 20 weeks of urine preservation on Whatman filter papers. The kappa values with 95% CIs were used to determine the concordance between Kato-katz test and POC-CCA to Point-of-care circulating cathodic test. These values were interpreted according to the classification of Landis et al. (50). Sample size was assessed using a paired-proportion approach based on McNemar’s test. The calculation considered a two-sided significance level of 5% and statistical powers of 80% and 90% to detect the observed difference in PCR amplification between extraction methods. This was done using the online software Statulator (https://statulator.com/SampleSize/ss2PP.html#). Considering a 6.3-percentage-point difference between the Chelex- and CTAB-based extraction methods and a statistical power of 90%, the estimated sample size was 161 samples. Differences were considered significant for p values < 0.05.

3 Results

3.1 Characteristics of urine samples used

For this study, 174 urine samples, including 120 with and 54 without S. haematobium eggs as revealed by the urine filtration test, were selected and analyzed. These samples were selected because sufficient urine was available for filtration onto at least 6 punched discs of Whatman filter paper.

3.2 Performance of three DNA extraction methods for extracting S. haematobium DNA from punched discs of Whatman filter paper on which urine samples were filtered

For 20 urine samples filtered onto Whatman filter paper and stored for 1 week, DNA extracted using each of the three DNA extraction methods yielded specific 365 bp S. haematobium COX 1 DNA fragments. This corresponded to a percentage of urine samples having S. haematobium DNA of 100% for each of the three DNA extraction methods.

3.3 Capacity of Whatman filter paper to filter urine samples and store some of their components for molecular detection of S. haematobium infections

In addition to the 20 urine samples tested above, 100 other urine samples with S. haematobium eggs were tested. This gave a total of 120 urine samples with S. haematobium eggs that were analyzed after 3, 12, and 20 weeks of storage on punched discs of Whatman filter paper on which urine samples were filtered. Of these 120 samples, amplification of S. haematobium COX1 DNA fragments in DNA extracts from the three extraction methods was observed for some samples but not for others (Figure 3). A subset of amplified products separated by agarose gel electrophoresis showed differences in the amplification rates among DNA extracts obtained using the Chelex-based method (Figure 3A), CTAB-based method (Figure 3B), and the commercial kit (Figure 3C). DNA extracts from sample 5’ (Figure 3B) obtained using the CTAB-based method, and those from samples 2”, 7”, 8”, and 10” obtained using the commercial kit (Figure 3C) did not amplify.

Photograph of an agarose gel showing amplified DNA fragments indicating the presence of *S. haematobium* infections in urine samples stored on Whatman filter paper and extracted using the Chelex-based method **(A)**, the CTAB-based method **(B)**, and the Zymo kit **(C)**. C−, negative control; C+, positive control; 1-9, 1’-4’, 6’-9’, 1”, 3”-6”, 9”, and 11”, urine samples harboring *S. haematobium*; 5’, 2”, 7”, 8”, and 10”, samples harboring *S. haematobium* that did not amplify by PCR; L, 100 pb ladder.
Figure 3. Photograph of an agarose gel showing amplified DNA fragments indicating the presence of S. haematobium infections in urine samples stored on Whatman filter paper and extracted using the Chelex-based method (A), the CTAB-based method (B), and the Zymo kit (C). C−, negative control; C+, positive control; 1-9, 1’-4’, 6’-9’, 1”, 3”-6”, 9”, and 11”, urine samples harboring S. haematobium; 5’, 2”, 7”, 8”, and 10”, samples harboring S. haematobium that did not amplify by PCR; L, 100 pb ladder.

All DNA extracts obtained using the Chelex-based method from the 120 punched discs of Whatman filter paper on which urine samples were filtered and stored for either 3 or 12 weeks yielded specific COX1 DNA fragments of S. haematonbium; giving thus a percentage of urine samples having S. haematobium DNA of 100% for punched discs of Whatman filter paper on which urine samples were filtered and stored for 3 and 12 weeks (Figure 3A). This percentage decreased to 99.2% after 20 weeks of storage on punched discs of Whatman filter paper on which urine samples were filtered (Table 1). Comparing the percentage of urine samples having S. haematobium DNA for this DNA extraction method, no significant difference (χ2 = 2, P = 0.37) was recorded between storage times.

Table 1. Amplification rates of specific S. haematobium DNA fragments according to extraction methods and storage duration of urine samples on Whatman filter paper.

Storage duration (weeks)Total nNumber of samples amplified using a DNA extraction method (%)
Chelex-based methodCTAB-based methodZymo Research kitχ2P-value
3120120 (100%)119 (99.2%)120 (100%)20.37
12120120 (100%)117 (97.5%)109 (90.8%)14.420.0007
20120119 (99.2%)116 (96.7%)96 (80.0%)35.18<0.0001
χ22227.40––
P value0.370.37<0.0001––

Total n, total number of samples analyzed; χ2, chi-square test of Cochran’s Q.

For DNA extracts obtained using the CTAB-based method from the 120 punched discs of Whatman filter paper on which urine samples were filtered and stored for 3, 12, and 20 weeks, specific COX1 DNA fragments of S. haematobium were amplified (Figure 3B) in 119, 117, and 116 samples; corresponding to a percentage of urine samples having S. haematobium DNA of 99.2%, 97.5%, and 96.7%, respectively, after 3, 12, and 20 weeks of storage. Comparison of these percentages showed no significant difference (χ2 = 2, P = 0.37) between storage times (Table 1).

For DNA extracts obtained using the commercial kit from the 120 punched discs of Whatman filter paper stored for 3, 12, and 20 weeks, specific COX1 DNA fragments of S. haematobium were amplified (Figure 3C) in 120, 109, and 96 samples, corresponding to amplification rates of 100%, 90.8%, and 80%, respectively, after 3, 12, and 20 weeks of storage. Comparison of these percentages showed a significant difference (χ2 = 27.40, P< 0.0001) between storage times, with the amplification rate being lowest after 20 weeks of storage (Table 1).

Comparing the percentage of urine samples having specific COX1 DNA fragments of S. haematobium, significant differences were recorded between the three DNA extraction methods after 12 (χ2 = 14.42; P = 0.0007) and 20 weeks (χ2 = 35.18; P < 0.0001) of storage on punched discs of Whatman filter paper on which urine samples were filtered (Table 1). After 3 weeks of storage, no significant difference (χ2 = 2; P < 0.37) was recorded among the three DNA extraction methods (Table 1).

For the 54 urine samples without S. haematobium eggs that were filtered and stored on Whatman filter paper for 12 weeks, specific S. haematobium COX1 DNA fragments were detected in 9 (16.7%) and 17 (31.5%) DNA extracts obtained using the Chelex-based and CTAB-based methods, respectively (Table 2).

Table 2. Performance of PCR for the detection of S. haematobium infections using DNA extracts obtained with the Chelex-based and CTAB-based DNA extraction methods.

Performance of PCR based on the Chelex-based DNA extraction method
Urine filtration test resultsTotal
PositiveNegative
Performance of PCR based on the CTAB-based DNA extraction method
Urine filtration test resultsTotal
PositiveNegative
PCR resultsPositive120a/119b(TP)9a/12b (FP)129a/131b
Negative0a/1b (FN)45a/42b (TN)45a/43b
Total12054174
Sensitivity (%)100a/99.2b
Specificity (%)83.3a/77.8b
NPV (%)100a/97.7b
PPV (%)93a/90.8b
Positive117c/116d (TP)17c/20d (FP)134c/136d
Negative3c/4d (FN)37c/34d (TN)40c/38d
Total12054174
Sensitivity (%)97.5c/96.7d
Specificity (%)68.5c/63d
NPV (%)92.5c/89.5d
PPV (%)87.3c/85.3d

values obtained using the Chelex-based extraction method after 12 weeks of storage of urine samples on filter papers; bvalues obtained using the Chelex-based extraction method after 20 weeks of storage of urine samples on filter papers; TP: true positive; TN: true negative; FP: false positive; FN: false negative; cvalues obtained using the CTAB-based extraction method after 12 weeks of storage of urine samples on filter papers; dvalues obtained using the CTAB-based extraction method after 20 weeks of storage of urine samples on filter papers.

3.4 Performance of Chelex and CTAB DNA extraction methods for molecular diagnosis of S. haematobium infections

Of the 174 urine samples, including 120 with and 54 without S. haematobium eggs, concordant results between the urine filtration test and PCR using DNA extracts obtained with the Chelex-based method were obtained for 165 (120 positive and 45 negative by both tests) and 161 (119 positive and 42 negative by both tests) samples after 12 and 20 weeks of storage, respectively (Table 2). The concordance index, expressed as the kappa coefficient, was 0.87 (P < 0.0001; 95% CI: 0.79–0.95) and 0.81 (P < 0.0001; 95% CI: 0.72–0.91), indicating good agreement between the urine filtration test and PCR results obtained using DNA extracts from the Chelex-based method after 12 and 20 weeks of urine preservation on Whatman filter paper, respectively. The sensitivity, specificity, negative predictive value (NPV), and positive predictive value (PPV) of PCR for the detection of S. haematobium infections using DNA extracts from the Chelex-based method were 100%, 83.3%, 100%, and 93%, respectively, after 12 weeks of storage on punched discs of Whatman filter paper. After 20 weeks of storage, these values decreased to 99.2%, 77.8%, 97.7%, and 90.8%, respectively (Table 2).

Of the 174 samples analyzed, concordant results between the urine filtration test and PCR using DNA extracts obtained with the CTAB-based method were obtained for 154 (117 positive and 37 negative by both tests) and 150 (116 positive and 34 negative by both tests) samples after 12 and 20 weeks of storage, respectively (Table 2). The concordance index, expressed as the kappa coefficient, was 0.71 (P < 0.0001; 95% CI: 0.59–0.82) and 0.65 (P < 0.0001; 95% CI: 0.52–0.77), indicating good agreement between the urine filtration test and PCR results obtained using DNA extracts from the CTAB-based method after 12 and 20 weeks of urine preservation on Whatman filter paper, respectively. The sensitivity, specificity, NPV, and PPV of PCR performed using DNA extracts obtained with the CTAB-based method were 97.5%, 68.5%, 92.5%, and 87.3%, respectively, after 12 weeks of storage on punched discs of Whatman filter paper. After 20 weeks, these values decreased to 96.7%, 63%, 89.5%, and 85.3%, respectively (Table 2).

Of the 174 samples with and without S. haematobium eggs that were tested after 12 weeks of storage, concordant results between the Chelex- and CTAB-based methods were obtained for 163 DNA extracts: S. haematobium DNA was detected in 154 extracts by both methods, while no S. haematobium DNA was detected in 9 extracts. Discordant results were obtained for 11 DNA extracts. Comparison of the proportions of samples in which S. haematobium infections were detected showed a significant difference (P= 0.001) between the two DNA extraction methods (Table 3, Figure 4). The Chelex-based method revealed S. haematobium DNA fragments in 94.8% (165/174) and 92.5% (161/174) of DNA extracts from Whatman filter paper on which urine samples were filtered and stored for 12 and 20 weeks, respectively (Figure 4). For the CTAB-based method, S. haematobium DNA fragments were detected in 88.5% (154/174) and 86.2% (150/174) of DNA extracts from Whatman filter paper on which urine samples were filtered and stored for 12 and 20 weeks, respectively (Figure 4). Comparison of the results obtained using the DNA extracts from the two extraction methods showed a discrepancy of approximately 6.3%, with the Chelex-based method showing higher performance.

Table 3. Paired comparison of PCR amplification results between the Chelex- and CTAB-based DNA extraction methods.

CTAB-based methodTotal
PositiveNegative
Chelex-basedmethodPositive154a/150b11a/11b165a/161b
Negative0a/0b9a/13b9a/13b
Total154a/150b20a/24b174

values obtained using the Chelex-based extraction method after 12 weeks of storage of urine samples on filter papers; bvalues obtained using the Chelex-based extraction method after 20 weeks of storage of urine samples on filter papers.

Paired comparison of PCR amplification results between the Chelex- and CTAB-based DNA extraction methods.
Figure 4. Paired comparison of PCR amplification results between the Chelex- and CTAB-based DNA extraction methods.

3.5 Cost estimates for DNA extraction from urine samples using the Chelex-based method, the CTAB-based method, and commercial kits

The prices of reagents and consumables needed to extract DNA from discs of Whatman filter paper using the Chelex- and CTAB-based methods are listed in Table 4. The costs related to the extraction of one disc of Whatman filter paper using the Chelex-based method and the CTAB-based method were estimated at €0.24 and €0.70, respectively (Table 4). For the commercial kits, the estimated cost of extracting one sample ranged from €2.2 to €16.5 (Table 5). Moreover, the estimated time required for DNA extraction was 1 h for the Chelex-based method, whereas the CTAB-based method and commercial kit required more than 24 h.

Table 4. Costs of reagents and consumables used for the Chelex-based DNA extraction method and the CTAB-based extraction method.

Estimated costs for the Chelex-based method
ReagentsQuantityUnit priceQuantity required for each extractionCost per extraction
Estimated costs for the CTAB-based method
ReagentsQuantityUnit priceQuantity required for each extractionPrice of each extraction
Chelex100 g€3490.015 g€0.05235
Nuclease-free water (95284-1L)1,000 mL€154300 µL€0.0462
Microtubes 1.5 mL (HS4323)500€23.202€0.0928
Yellow tips (EP0030000870)1000€50.401€0.0504
Total€0.24
CTAB (H6269-1KG)1,000 g€7770.014 g€0.0109
Tris base (T1503-1KG)1,000 g€3030.008477 g€0.0026
EDTA (E9884-1KG)1,000 g€2830.0052108 g€0.0015
NaCl (S9888-1KG)1,000 g€53.600.057232 g€0.0030
β-mercaptoethanol (M6250)1,000 mL€1820.002 mL€0.0036
Chloroform (32211-1L)1,000 mL€1100.672 mL€0.0739
Isoamyl alcohol (W205702-1KG-K)1,000 mL€73.200.028 mL€0.0020
Isopropanol (I9516-1L)1,000 mL€1160.45 mL€0.0522
Absolute alcohol (1070174000)4,000 mL€97.801.4 mL€0.0342
Nuclease-free water (9528461L)1,000 mL€1541.754 mL€0.2701
Microtubes 1.5 mL (HS4323)500€23.202€0.0928
Blue tips (CLS4868)1000€51.403€0.1542
Total€0.70

Values in bold represent the total cost estimated.

Table 5. Costs of DNA extraction for a single urine sample using commercial kits.

Kit nameQuantity (preps)Price of one kitCost per sample extracted
Quick-DNA Miniprep Plus Kit (Zymo Research)200€589.34€3.2
QIAamp DNA Blood Mini kit (Cat. No./ID: 51106)250€885.38€3.9
QIAamp DNA Blood Midi kit (Cat. No./ID: 51183)20€299.58€16.5
HigherPurity™ Blood DNA Extraction Kit50€111.82€2.2
Norgen Biotek Corp Blood DNA Isolation Mini Kit (SKU 46300)100€281.45€3.1
Norgen Biotek Corp Blood DNA Isolation Midi (Kit SKU 51400)20€205.13€11.3
Thermo Scientific™ GeneJET Whole Blood Genomic DNA Purification Mini Kit (K0782)250€795.6€3.2
Urine DNA Isolation Kits (Norgen, SKU18100)50€453.18€9.1
Quick-DNA Urine Kit (D3061)50€493.25€9.9

4 Discussion

Although parasitological methods relying on the urine filtration test have been widely used to diagnose urinary schistosomiasis, this technique is becoming less sensitive in most epidemiological settings due to preventive chemotherapy, which has led to a considerable reduction in the prevalence and infection intensities of S. haematobium infections. In addition, storage of urine samples on an appropriate medium before their handling and transportation to laboratories is critical, especially in the current elimination context, in which thousands of samples must be analyzed using reliable and accurate diagnostic tools. This study was designed to comparatively evaluate three methods for extracting S. haematobium DNA from urine samples stored on Whatman filter paper at different storage time points.

The amplification of COX1 DNA fragments specific to S. haematobium in DNA extracts from discs of Whatman filter paper on which urine samples were filtered and stored for several weeks indicates that the filter paper can preserve urine components required for the molecular detection of S. haematobium infections. These results are consistent with previous observations reporting the capacity of these filter papers to store and preserve biological samples for molecular identification of S. haematobium (25, 27, 28, 34). Moreover, the amplification of a specific COX1 DNA fragment of S. haematobium in DNA extracts obtained using the Chelex- and CTAB-based methods indicates the capacity of these methods not only to disrupt the membranes of S. haematobium eggs and release nucleic acids, but also to yield DNA extracts free of DNA polymerase inhibitors.

The successful amplification of all 20 DNA extracts obtained using either the Chelex- or CTAB-based method indicates the capacity of both methods to extract S. haematobium DNA from stored urine samples for molecular detection of this parasite. The amplification of specific COX1 DNA fragments of S. haematobium in DNA extracts obtained using the CTAB-based method is consistent with previous studies (35, 36, 51) that highlighted the ability of this method to yield DNA extracts free of PCR inhibitors. As urine samples contain strong PCR inhibitors such as urea, nitrites, and hemoglobin, the use of a chloroform/isoamyl alcohol mixture combined with washing steps probably enabled the removal of residual inhibitors (22, 23, 52, 53).

Results obtained with DNA extracts from the Chelex-based method are consistent with previous studies reporting the capacity of this method to extract DNA from S. haematobium and a wide range of pathogens in different biological samples (38, 54–59). The capacity of the Chelex-based method to yield DNA extracts free of PCR inhibitors may be explained by the alkalinity of the Chelex resin and the high temperature used during the extraction process. The alkalinity of the Chelex suspension combined with high temperature probably induced disruption of S. haematobium egg membranes and, subsequently, the release of nucleic acids (60, 61). In addition, the Chelex resin, composed of styrene divinylbenzene copolymers containing paired iminodiacetate ions, acts as a chelator for polyvalent metal ions and can therefore inhibit DNA degradation by chelating metal ions (62). These chelating groups bind to the cellular components released during the heat-shock process and protect DNA from degradation. Compared to other methods, the Chelex-based method appeared more efficient and less time-consuming because DNA extraction can be completed in 1 h (38), while more than 24 h are required for the CTAB-based method (36). The Chelex-based method can therefore be used as an alternative to the commercial kit that has previously been used to extract S. haematobium DNA from urine samples.

The amplification of COX1 DNA fragments in all 120 DNA extracts from urine samples filtered through discs of Whatman filter paper that were stored for 3–12 weeks and extracted using the Chelex-based method supports the use of this extraction method for molecular diagnosis of urinary schistosomiasis. These results are consistent with those of Phillips et al. (62), who reported no significant difference when comparing the Chelex-based method with two commercial kits (Qiagen DNA Investigator Kit and QIAcube). Compared to the CTAB-based method and the commercial kit, DNA extracts from the Chelex-based method yielded the highest amplification rates of S. haematobium DNA fragments at different storage time points. In addition, the Chelex-based method is simple to perform, less time-consuming, and cost-effective (38, 58, 63);. Therefore, it appears to be a suitable DNA extraction method for molecular diagnosis of urinary schistosomiasis. Despite a slight reduction in the S. haematobium amplification rate (to 99.2%) in DNA extracts from the Chelex-based method after 20 weeks of storage on discs of Whatman filter paper, no significant difference was reported after 3 and 12 weeks of storage. This result highlights the capacity of Whatman filter paper to efficiently retain and store urine components, including S. haematobium eggs or cell-free DNA, for up to 20 weeks for molecular diagnosis of urinary schistosomiasis. Similar results were obtained with DNA extracts from the CTAB-based method and the commercial kit, where the percentage of urine samples having S. haematobium DNA significantly decreased after 12 and 20 weeks of storage on Whatman filter paper on which urine samples were filtered. These results suggest progressive degradation of S. haematobium components (eggs or cell-free DNA of S. haematobium) on Whatman filter paper after 12 weeks of storage (64). Moreover, inappropriate storage conditions, sample heterogeneity, loss of amplifiable DNA during the extraction process, and inhibitor accumulation in DNA extracts cannot be excluded as other factors that may explain the decline in amplification rate after 20 weeks of urine preservation on Whatman paper (65, 66).

The amplification of S. haematobium DNA in all DNA extracts obtained using the commercial kit after 3 weeks of storage is consistent with the results of previous studies (27, 28, 34). However, the significant decrease in the amplification rates of S. haematobium in DNA extracts from the commercial kit after 12 and 20 weeks of storage is difficult to explain. Nevertheless, the presence of residual PCR inhibitors in DNA extracts from the commercial kit cannot be ruled out. This hypothesis is supported by electrophoretic results showing clearer and more intense amplicon bands in DNA extracts obtained using the Chelex- and CTAB-based methods than in those obtained using the commercial kit. In addition, comparative studies of several DNA extraction methods have reported that some DNA extraction methods, such as the CTAB-based method, outperform commercial kits in terms of DNA yield, purity, and concentration (67).

The findings of this study, showing both the capacity of Whatman filter paper to filter urine samples and preserve some of their components and the capacity of the Chelex-based method to extract DNA from filter paper stored for up to 20 weeks, are of epidemiological value for (i) diagnosing urinary schistosomiasis, (ii) supporting its control, and (iii) ensuring its elimination and post-elimination surveillance. This is critical at a time when thousands of samples will be analyzed to validate elimination and ensure post-elimination monitoring. The slightly lower sensitivity of the CTAB-based method than that of the Chelex-based DNA extraction method may be due to residual inhibitors, because studies have shown that some reagents in the CTAB-based method, such as chloroform, are potential PCR inhibitors if not adequately removed during DNA extraction (53). Nonetheless, it is important to point out that the performance of the molecular methods obtained in the present study must be interpreted with caution due to the well-known low sensitivity of the urine filtration test used as the gold standard during the assessment process.

At estimated costs of €0.24, €0.70, and €3.2 for the Chelex-based method, CTAB-based method, and commercial kit used in the present study, respectively, the cost for the Chelex-based method is 13.25 and 2.92 times cheaper than that of the commercial kit and CTAB-based method, respectively. These results are consistent with previous studies showing that the Chelex-based method is the cheapest method for extracting DNA from different samples compared to commercial kits (58). For nasopharyngeal samples, for instance, the costs of DNA extraction were 33 times cheaper for the Chelex-based method compared to commercial kits (58). The low cost of the Chelex-based method may be explained by the small number of steps and the use of less expensive reagents and fewer consumables (68, 69). The low cost of the Chelex-based method, combined with its capacity to extract S. haematobium DNA from urine samples with little or no PCR inhibitors, appears as a crucial argument supporting its use in large-scale epidemiological studies of urinary schistosomiasis in resource-limited endemic settings.

Compared to other DNA extraction methods used on urine samples, the Chelex-based method has several advantages: (i) it can disrupt cell membranes and release S. haematobium DNA from stored Whatman filter paper on which urine samples were filtered; (ii) it is cost-effective and easy to perform compared to commercial kits and CTAB-based method; iii) it is less time-consuming and requires fewer consumables and no harmful chemical products compared to the CTAB-based method; iv) it yields DNA extracts with little or no DNA polymerase inhibitors; (v) it has the capacity to extract DNA from various infectious agents in a single DNA extraction round; and vi) it can achieve satisfactory amplification rates of S. haematobium using a small volume of urine. Our results showed that PCR performed on DNA extracted from urine samples stored on Whatman filter paper accurately detected S. haematobium infections, with the Chelex-based method demonstrating higher sensitivity, specificity, and predictive values than the CTAB-based method. Although diagnostic performance slightly decreased after 20 weeks of storage, the Chelex-based DNA extraction method remained reliable for long-term molecular diagnosis.

Results of the present study showed that the Chelex-based method is a cost-effective, safe, simple, fast, and suitable method for extracting DNA from Whatman filter paper for molecular diagnosis of S. haematobium infections. This method is relevant, especially in developing countries, where DNA extraction costs and the handling and transportation of urine samples from remote areas to molecular biology laboratories are critical steps for molecular diagnosis of infectious diseases. By improving the diagnosis of urinary schistosomiasis, this DNA extraction method may have epidemiological implications for control, elimination, and post-elimination monitoring. Its use may enable not only to have the real epidemiological (prevalence and intensity of infections) situation of diseases in different endemic settings, but also to increase the probability of disease elimination by optimizing the frequency of mass drug administration (70). With more sensitive diagnostic tools, resources may be more efficiently deployed to improve health outcomes (70). Indeed, health impact modeling has shown that improving diagnostic methods may increase the probability of disease elimination by optimizing the frequency of mass drug administration (70). This may also improve disability-adjusted life years (DALYs). To some extent, it may lead to an earlier decision to stop MDA.

The fact that only one volume of urine (10 mL) was tested in this study constitutes a limitation because some children may be unable to provide this volume of urine. In this context, there is an urgent need to determine the lowest volume of urine that can be filtered or stored on Whatman No. 3 filter paper, which may enable the development of a mini-kit for the molecular diagnosis of urinary schistosomiasis under field conditions.

5 Conclusion

This study demonstrated the potential of Whatman filter paper for the transportation and storage of urine samples for up to 20 weeks before molecular diagnosis. Among the DNA extraction methods evaluated, the Chelex-based method emerged as the most suitable approach due to its simplicity, speed, affordability, and robust diagnostic performance. These findings highlight the potential of combining urine filtration on Whatman filter paper with Chelex-based DNA extraction as a cost-effective strategy for the molecular detection of Schistosoma haematobium, particularly in resource-limited settings where access to commercial extraction kits may be limited. This approach may facilitate large-scale epidemiological surveys aiming to monitor and evaluate control programs, validate schistosomiasis elimination, and ensure post-elimination surveillance.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Footnotes

Edited by: Hugues C. Nana Djeunga, Translational Research and Development Foundation (TREND Foundation), Cameroon

Reviewed by: Priscila Silva Grijó Farani, The University of Texas at El Paso, United States

Pang Jyh Chyang, University of Kuala Lumpur, Malaysia

Statements

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The handling editor HN declared a past co-authorship with the author GS.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This work received financial support from the Coalition for Operational Research on Neglected Tropical Diseases (COR-NTD), which is funded at The Task Force for Global Health primarily by the Bill & Melinda Gates Foundation and the United States Agency for International Development through its Neglected Tropical Diseases Program. The grant was administered by the African Research Network for Neglected Tropical Diseases (ARNTD); grant number SGPVI093/010.2023. This work was also being made possible thanks to philanthropic support through the London School of Tropical Medicine (LSTM) and administered by the Centre for Research in infectious Diseases.

Data availability

The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.

Ethics approval

The studies involving humans were approved by National Ethics Committee for research on human health of the Ministry of Public Health of Cameroon. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent for participation in this study was provided by the participants’ legal guardians/next of kin.

Author contributions

EMM: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Visualization, Writing – original draft, Writing – review & editing. ID: Investigation, Methodology, Writing – review & editing. DM: Investigation, Methodology, Writing – review & editing. ELM: Investigation, Methodology, Writing – review & editing. RA: Investigation, Methodology, Writing – review & editing. AT: Investigation, Methodology, Writing – review & editing. PF: Methodology, Writing – review & editing, Investigation. GS: Conceptualization, Methodology, Supervision, Writing – original draft, Writing – review & editing.

Acknowledgements

We are grateful for the support and participation of the inhabitants from the Matta health area. We would also like to thank school headmasters and teachers from the Matta health area for their good collaboration and assistance.

References

  1. 1 Stothard JR, Campbell SJ, Osei-Atweneboana MY, Durant T, Stanton MC, Biritwum NK. Towards interruption of schistosomiasis transmission in sub-Saharan Africa: developing an appropriate environmental surveillance framework to guide and to support 'end game' interventions. Infect Dis Poverty. (2017) 6: 10. doi: doi:10.1186/s40249-016-0215-9
  2. 2 WHO. Ending the neglect to attain the Sustainable Development Goals-A Road map for neglected tropical diseases 2021–2030. Geneva: World Health Organization (2020). Licence: CC BY-NC-SA 3.0 IGO.
  3. 3 WHO. Schistosomiasis and soil-transmitted helminthiases: numbers of people treated in 2018. Weekly Epidemiol Rec. (2018) 94: 601–12.
  4. 4 Quansah R, Murad M, DansoAppiah T, Guure C, Yakubu A, Codjoe AB. The effectiveness of praziquantel preventive chemotherapy on morbidity in schistosomiasis: a systematic review and meta-analysis. Medrxiv. (2021). doi: doi:10.1101/2021.11.03.21265867
  5. 5 Hotez PJ, Fenwick A. Schistosomiasis in Africa: an emerging tragedy in our new global health decade. PloS Negl Trop Dis. (2009) 3: e485. doi: doi:10.1371/journal.pntd.0000485
  6. 6 Clerinx J, Bottieau E, Wichmann D, Tannich E, Van Esbroeck M. Acute schistosomiasis in a cluster of travelers from Rwanda: diagnostic contribution of schistosome DNA detection in serum compared to parasitology and serology. J Travel Med. (2011) 18: 367–72. doi: doi:10.1111/j.1708-8305.2011.00552.x
  7. 7 Pennington LF, Hsieh MH. Immune response to parasitic infections. In: Bentham Ebooks, Bentham Science Publisher, Sharjah. (2014) 2: 93–124. doi: doi:10.2174/97816080598501140201
  8. 8 Giboda M, Bergquist R, Utzinger J. Schistosomiasis at the crossroad to elimination: review of eclipsed research with emphasis on the post-transmission agenda. Trop Med Infect Dis. (2022) 7: 55. doi: doi:10.3390/tropicalmed7040055
  9. 9 Tian-Bi YT, Ouattara M, Knopp S, Coulibaly JT, Hürlimann E, Webster B. Interrupting seasonal transmission of Schistosoma haematobium and control of soil-transmitted helminthiasis in northern and central Côte d’Ivoire: a SCORE study protocol. BMC Public Health. (2018) 18: 186. doi: doi:10.1186/s12889-018-5044-2
  10. 10 WHO. Helminth Control in School Age Children: A Guide for Managers of Control Programmes. 2nd Ed. Geneva: World Health Organization (2011).
  11. 11 Knopp S, Becker SL, Ingram KJ, Keiser J, Utzinger J. Diagnosis and treatment of schistosomiasis in children in the era of intensified control. Expert Rev Anti Infect Ther. (2013) 11: 1237–58. doi: doi:10.1586/14787210.2013.844066
  12. 12 Bergquist R, Zhou XN, Rollinson D, Reinhard-Rupp J, Klohe K. Elimination of schistosomiasis: The tools required. Infect Dis Poverty. (2017) 6: 158. doi: doi:10.1186/s40249-017-0370-7
  13. 13 He P, Song LG, Xie H, Liang JY, Yuan DY, Wu ZD. Nucleic acid detection in the diagnosis and prevention of schistosomiasis. Infect Dis poverty. (2016) 5: 1 – 11. doi: doi:10.1186/s40249-016-0116-y
  14. 14 Shiff C. Accurate diagnostics for schistosomiasis: A new role for PCR ? Rep Parasitol. (2015) 4: 23–9. doi: doi:10.2147/rip.s74319
  15. 15 WHO. Expert Consultation to Accelerate Elimination of Asian Schistosomiasis. Shanghai, China: WHO (2017).
  16. 16 He P, Gordon CA, Williams GM, Li Y, Wang Y, Hu J. Real-time PCR diagnosis of Schistosoma japonicum in low transmission areas of China. Infect Dis Poverty. (2018) 7: 8. doi: doi:10.1186/s40249-018-0390-y
  17. 17 Knopp S, Ame SM, Hattendorf J, Ali SM, Khamis IS, Bakar F. Urogenital schistosomiasis elimination in Zanzibar: accuracy of urine filtration and haematuria reagent strips for diagnosing light intensity Schistosoma haematobium infections. Parasit Vectors. (2018) 11: 552. doi: doi:10.1186/s13071-018-3136-6
  18. 18 Amoah SA, Hoekstra TP, Casacuberta-Partal M, Coffeng EL, Corstjens LAMP, Greco B. Sensitive diagnostic tools and targeted drug administration strategies are needed to eliminate schistosomiasis. Lancet Infect Dis. (2020) 20: e165–72. doi: doi:10.1016/s1473-3099(20)30254-1
  19. 19 Stothard JR, Kabatereine N, Tukahebwa EM, Kazibwe F, Rollinson D, Mathieson W. Use of circulating cathodic antigen (CCA) dipsticks for detection of intestinal and urinary schistosomiasis. Acta Trop. (2006) 97: 219–28. doi: doi:10.1016/j.actatropica.2005.11.004
  20. 20 Ochodo EA, Gopalakrishna G, Spek B, Reitsma JB, van Lieshout L, Polman K. Circulating antigen tests and urine reagent strips for diagnosis of active schistosomiasis in endemic areas. Cochrane Database Syst Rev. (2015) 11: CD009579. doi: doi:10.1002/14651858.CD009579.pub2
  21. 21 Choi HL, Ducker C, Braniff S, Argaw D, Solomon AW, Borisch B. Landscape analysis of NTD diagnostics and considerations on the development of a strategy for regulatory pathways. PloS Negl Trop Dis. (2022) 16: e0010597. doi: doi:10.1371/journal.pntd.0010597
  22. 22 Khan G, Kangro HO, Coates PJ, Heath RB. Inhibitory effects of urine on the polymerase chain reaction for cytomegalovirus DNA. J Clin Pathol. (1991) 44: 360–5. doi: doi:10.1136/jcp.44.5.360
  23. 23 Mahony J, Chong S, Jang D, Luinstra K, Faught M, Dalby D. Urine specimens from pregnant and nonpregnant women inhibitory to amplification of Chlamydia trachomatis nucleic acid by PCR, ligase chain reaction, and transcription mediated amplification: identification of urinary substances associated with inhibition. J Clin Microbiol. (1998) 36: 3122–6. doi: doi:10.1128/jcm.36.11.3122-3126.1998
  24. 24 Manzano-Roman R, Siles-Lucas M. MicroRNAs in parasitic diseases: potential for diagnosis and targeting. Mol Biochem Parasitol. (2012) 186: 81–6. doi: doi:10.1016/j.molbiopara.2012.10.001
  25. 25 Ibironke OA, Phillips AE, Garba A, Lamine SM, Shiff C. Diagnosis of Schistosoma haematobium by detection of specific DNA fragments from filtered urine samples. Am J Trop Med Hyg. (2011) 84 (6): 998 – 1001. doi: doi:10.4269/ajtmh.2011.10-0691
  26. 26 Kato-Hayashi N, Yasuda M, Yuasa J, Isaka S, Haruki K, Ohmae H. Use of cell-free circulating schistosome DNA in serum, urine, semen, and saliva to monitor a case of refractory imported schistosomiasis hematobia. J Clin Microbiol. (2013) 51: 3435–8. doi: doi:10.1128/JCM.01219-13
  27. 27 Hessler MJ, Cyrs A, Krenzke SC, Mahmoud ES, Sikasunge C, Mwansa J. Detection of duo-schistosome infection from filtered urine samples from school children in Zambia after MDA. PloS One. (2017) 12: e0189400. doi: doi:10.1371/journal.pone.0189400
  28. 28 Anyan WK, Pulkkila RB, Dyra EC, Price M, Naples MJ, Quartey KJ. Assessment of dual schistosome infection prevalence from urine in an endemic community of Ghana by molecular diagnostic approach. Parasite Epidemiol Control. (2020) 9: e00130. doi: doi:10.1016/j.parepi.2019.e00130
  29. 29 Tembo R, Muleya W, Yabe J, Kainga H, Nalubamba KS, Zulu M. Prevalence and Molecular Identification of Schistosoma haematobium among Children in Lusaka and Siavonga Districts, Zambia. Trop Med Infect Dis. (2022) 7: 239. doi: doi:10.3390/tropicalmed7090239
  30. 30 Sow D, Sylla K, Dieng NM, Senghor B, Gaye PM, Fall CB. Molecular diagnosis of urogenital schistosomiasis in pre-school children, school-aged children and women of reproductive age at community level in central Senegal. Parasit Vectors. (2023) 16: 43. doi: doi:10.1186/s13071-023-05671-x
  31. 31 Kouna LC, Oyegue-Liabagui SL, Atiga CN, Mbani Mpega Ntigui CN, Imboumy-Limoukou RK, Biteghe Bi Essone JC. Molecular detection of urogenital schistosomiasis in community level in semi-rural areas in South-East Gabon. Diagnostics (Basel). (2025) 15: 1052. doi: doi:10.3390/diagnostics15091052
  32. 32 Bergallo M, Costa C, Gribaudo G, Tarallo S, Baro S, Negro Ponzi A. Evaluation of six methods of extraction and purification of viral DNA from urine and serum samples. New Microbiol. (2006) 29: 111–9.
  33. 33 Sarhan RM, Kamel HH, Saad GA, Ahmed OA. Evaluation of three extraction methods for molecular detection of Schistosoma mansoni infection in human urine and serum samples. J Parasit Dis. (2015) 39: 499 – 507. doi: doi:10.1007/s12639-013-0385-3
  34. 34 Lodh N, Mwansa JC, Mutengo MM, Shiff CJ. Diagnosis of Schistosoma mansoni without the stool: comparison of three diagnostic tests to detect Schistosoma [corrected] mansoni infection from filtered urine in Zambia. Am J Trop Med Hyg. (2013) 89: 46 – 50. doi: doi:10.4269/ajtmh.13-0104
  35. 35 Kamdem CN, Fogue PS, Tiofack AAZ, Mewamba EM, Womeni HM, Koffi M. Assessment of acetyl-trimethyl-ammonium bromide (CTAB) based method for the extraction of soil-transmitted helminth DNAs from stools for molecular dagnostic of soil-transmitted helminthiasis. J Microbiol Method. (2023) 204: 106661. doi: doi:10.1016/j.mimet.2022.106661
  36. 36 Kamdem NC, Fogue SP, Tiofack ZAA, Mewamba ME, Mengoue TLE, Womeni MH. Assessment of the capacity of Whatman filter papers as support to store stools for the molecular diagnostic testing of soil-transmitted helminthiasis. J Microbiol Methods. (2023) 213: 106824. doi: doi:10.1016/j.mimet.2023.106824
  37. 37 Smit PW, Elliott I, Peeling RW, Mabey D, Newton PN. An overview of the clinical use of filter paper in the diagnosis of tropical diseases. Am J Trop Med Hyg. (2014) 90: 195–9. doi: doi:10.4269/ajtmh.13-0463
  38. 38 Panda BB, Meher AS, Hazra RK. Comparison between different methods of DNA isolation from dried blood spots for determination of malaria to determine specificity and cost effectiveness. J Parasit Dis. (2019) 43: 337–42. doi: doi:10.1007/s12639-019-01136-0
  39. 39 Fuss A, Mazigo HD, Mueller A. Detection of Schistosoma mansoni DNA using polymerase chain reaction from serum and dried blood spot card samples of an adult population in North-western Tanzania. Infect Dis Poverty. (2021) 10: 15. doi: doi:10.1186/s40249-021-00798-4
  40. 40 Miller K, Choudry J, Mahmoud ES, Lodh N. Accurate Diagnosis of Schistosoma mansoni and S. haematobium from Filtered Urine Samples Collected in Tanzania, Africa. Pathogens. (2024) 13: 59. doi: doi:10.3390/pathogens13010059
  41. 41 Mewamba EM, Tekeu Mengoue LE, Motia DB, Atiokeng Tatang RJ, Zebaze Tiofack AA, Simo G. Distribution of schistosomes and soil-transmitted helminth infections and their association with growth and nutritional status of School-aged children of the Matta health area in the West region of Cameroon. PloS Negl Trop Dis. (2025) 19: e0013606. doi: doi:10.1371/journal.pntd.0013606
  42. 42 WHO. The Prevention and Control of Schistosomiasis and Soil Transmitted Helminthiasis. Report of a WHO Expert Committee. WHO Tech. Rep. Ser. Geneva (2002). No.912157.
  43. 43 Mewabo AP, Moyou RS, Kouemeni LE, Ngogang JY, Kaptue L, Tambo E. Assessing the prevalence of urogenital schistosomaisis and transmission risk factors amongst school-aged children around Mapé dam ecological suburbs in Malantouen district, Cameroon. Infect Dis Poverty. (2017) 6: 40. doi: doi:10.1186/s40249-017-0257-7
  44. 44 Tchuem Tchuenté LA, Kamwa Ngassam RI, Sumo L, Ngassam P, Dongmo Noumedem C, Nzu DD. Mapping of schistosomiasis and soil-transmitted helminthiasis in the regions of centre, East and West Cameroon. PloS Negl Trop Dis. (2012) 6: e1553. doi: doi:10.1371/journal.pntd.0001553
  45. 45 Njunda AL, Ndzi EN, Assob JCN, Kamga HLF, Kwenti ET. Prevalence and factors associated with urogenital schistosomiasis among primary school children in barrage, Magba sub-division of Cameroon. BMC Public Health. (2017) 17: 618. doi: doi:10.1186/s12889-017-4539-6
  46. 46 Bong BGG, Metiendjo V, Mimfoumou AHG, Ngounouh TC, Nguwoh PS. Urinary schistosomiasis prevalence and risk factors among school children at matta-barrage in the Tikar Plain of Magba, West Region, Cameroon: A situational analysis in rural area. World J Advanced Res Rev. (2022) 14: 532–40. doi: doi:10.30574/wjarr.2022.14.3.0596
  47. 47 Mengoue LET, Tatang RJA, Fogue PS, Mewamba EM, Tiofack AAZ, Kamga RMN. Schistosome infections and other gastrointestinal parasites in cattle of the Magba sub-division in the West region of Cameroon. Vet Parasitol Reg Stud Rep. (2025) 58: 101199. doi: doi:10.1016/j.vprsr.2025.101199
  48. 48 Program Nationale de la Lutte Contre la Schistosomiase et les Helminths du Cameroun. Plan Strategique 2005 -2010. Cameroon: MINSANTE (2005), 92.
  49. 49 Peters PA, Mahmoud AA, Warren KS, Ouma JH, Siongok TK. Field studies of a rapid, accurate means of quantifying Schistosoma haematobium eggs in urine samples. Bull World Health Organ. (1976) 54: 159–62.
  50. 50 Landis JR, Koch GG. An application of hierarchical kappa-type statistics in the assessment of majority agreement among multiple observers. Biometrics. (1977) 33: 363–74. doi: doi:10.2307/2529786
  51. 51 Hunter ME, Ferrante JA, Meigs-Friend G, Ulmer A. Improving eDNA yield and inhibitor reduction through increased water volumes and multi-filter isolation techniques. Sci Rep. (2019) 9: 5259. doi: doi:10.1038/s41598-019-40977-w
  52. 52 Zhang BW, Li M, Ma LC, Wei FW. A widely applicable protocol for DNA isolation from fecal samples. Biochem Genet. (2006) 44: 494 – 503. doi: doi:10.1007/s10528-006-9050-1
  53. 53 Demeke T, Jenkins GR. Influence of DNA extraction methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits. Anal Bioanal Chem. (2010) 396: 1977–90. doi: doi:10.1007/s00216-009-3150-9
  54. 54 de Lamballerie X, Zandotti C, Vignoli C, Bollet C, de Micco P. A one-step microbial DNA extraction method using “Chelex 100” suitable for gene amplification. Res Microbiol. (1992) 143: 785–90. doi: doi:10.1016/0923-2508(92)90107-y
  55. 55 Walsh PS, Metzger DA, Higuchi R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques. (2013) 54: 506–13. doi: doi:10.2144/000114018
  56. 56 Singh UA, Kumari M, Iyengar S. Method for improving the quality of genomic DNA obtained from minute quantities of tissue and blood samples using Chelex 100 resin. Biol Proced Online. (2018) 20: 12. doi: doi:10.1186/s12575-018-0077-6
  57. 57 Angora KE, Vangraefschepe A, Allienne JF, Menan H, Coulibaly JT, Aboulaye M. Population genetic structure of Schistosoma haematobium and Schistosoma haematobium x Schistosoma bovis hybrids among school-aged children in Côte d’Ivoire. Parasite. (2022) 29: 23. doi: doi:10.1051/parasite/2022023
  58. 58 Silva R, de Lima SC, dos Santos Reis WPM, de Magalhães JJF, Magalhães R, Rathi B. Comparison of DNA extraction methods for COVID-19 host genetics studies. PloS One. (2023) 18: e0287551. doi: doi:10.1371/journal.pone.0287551
  59. 59 Yang H, Zhou Q, Hu J, Bao Z, Wang M. A Chelex-100-based rapid DNA extraction method and its application in the detection of shrimp pathogens. Electron J Biotechnol. (2024) 70: 29–37. doi: doi:10.1016/j.ejbt.2024.04.004
  60. 60 Walsh PS, Metzger DA, Higuchi R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotech. (1991) 10: 506–13. doi: doi:10.2144/000114018
  61. 61 Gautam A. DNA isolation by Chelex method. In: DNA and RNA Isolation Techniques for non-Experts. Techniques in Life Science and Biomedicine for the non-Expert. Springer, Cham (2022). doi: doi:10.1007/978-3-030-94230-4_10
  62. 62 Phillips K, McCallum N, Welch L. A comparison of methods for forensic DNA extraction: Chelex-100® and the QIAGEN DNA Investigator Kit (manual and automated). Forensic Sci Int Genet. (2012) 6: 282–5. doi: doi:10.1016/j.fsigen.2011.04.018
  63. 63 Mao J, Lv J, Miao Y, Sun C, Hu L, Zhang R. Development of a rapid and efficient method for non-lethal DNA sampling and genotyping in scallops. PloS One. (2013) 8: e68096. doi: doi:10.1371/journal.pone.0068096
  64. 64 Smith LM, Burgoyne LA. Collecting, archiving and processing DNA from wildlife samples using FTA ® databasing paper. BMC Ecol. (2004) 4: 4. doi: doi:10.1186/1472-6785-4-4
  65. 65 Schrader C, Schielke A, Ellerbroek L, Johne R. PCR inhibitors – occurrence, properties and removal. J Appl Microbiol. (2012) 113: 1014–26. doi: doi:10.1111/j.1365-2672.2012.05384.x
  66. 66 Hedman J, Rådström P. Overcoming inhibition in real-time diagnostic PCR. Methods Mol Biol. (2013) 943: 17 – 48. doi: doi:10.1007/978-1-60327-353-4_2
  67. 67 Habibi N, Al Salameen F, Rahman M, Shajan A, Zakir F, Abdulrazzack N. Comparison and optimization of DNA isolation protocols for high throughput genomic studies of Acacia pachyceras Schwartz. MethodsX. (2022) 9: 101799. doi: doi:10.1016/j.mex.2022.101799
  68. 68 Aidar M, Line SRP. A simple and cost-effective protocol for DNA isolation from buccal epithelial cells. Braz Dent J. (2007) 8: 148–52. doi: doi:10.1590/s0103-64402007000200012
  69. 69 Edwin Shiaw CS, Shiran MS, Cheah YK, Tan GC, Sabariah AR. Evaluation of DNA and RNA extraction methods. Med J Malaysia. (2010) 65: 133–7. doi: doi:10.3390/computation8020030
  70. 70 Medley GF, Turner HC, Baggaley RF, Holland C, Hollingsworth TD. The role of more sensitive helminth diagnostics in mass drug administration campaigns: elimination and health impacts. Adv Parasitol. (2016) 94: 343–92. doi: doi:10.1016/bs.apar.2016.08.005

Citation

Mewamba, E. M., et al. (2026). Comparative assessment of three methods (Chelex-based method, commercial kit, and CTAB-based method) for extracting DNA from Whatman filter paper on which urine samples were filtered and stored for molecular diagnosis of urinary schistosomiasis. Frontiers in Tropical Diseases, Volume 7. https://doi.org/
Received
Accepted
Published
Volume
7 - 2026

Copyright

Copyright © 2026 Mewamba, Diengue, Motia, Mengoue, Atiokeng, Tiofack, Fogue and Simo.

License: https://creativecommons.org/licenses/by/4.0/

*Correspondence: Estelle Mezajou Mewamba

Article metrics

Views
0
Downloads
0
Citations
0
Shares
0

Related articles

Original ResearchCapacity strengthening for community health workers in trachoma prevention and referrals: a mixed-methods study in Al Sabra district, Ibb governorate, YemenLeen Daoud, Magid Al Gunaid, Aïssatou Diawara, Mahanna Elsheik, Alison Krentel, Sami A. Al-HaidariBrief Research ReportComparative genomic analysis of established and emerging anti-tubercular drug targets reveals evolutionary conservation and antimicrobial resistance patterns in Mycobacterium tuberculosis isolates from IndonesiaNi Made Puspawati, Iryanti Eka Suprihatin, Akshay Suthar, Ashaka Vansia, Rajesh PatelReviewThe global emergence of Trichophyton indotineae: epidemiology, resistance, and management challengesDipika Shaw, Adnan Omar, Michelle Singh, Merin Chandanathil, Chandana Bhargavi, Nagaraj Mysore, Dharam Bir, Srinidhi Ramasamy, Prasanna Honnavar