ZFP36L1 negatively regulates autophagy and contributes to suppressing murine norovirus replication

Norovirus is a major cause of acute gastroenteritis worldwide, particularly in young children, and represents a significant public health concern. ZFP36L1, an RNA-binding protein, has demonstrated antiviral effects against several viruses, but its role in norovirus infection has not been previously studied. This study used murine norovirus 1 (MNV-1) as a model to investigate the antiviral role of ZFP36L1 against norovirus. The results show that overexpression of ZFP36L1 suppressed while knockdown of ZFP36L1 increased MNV-1 replication. MNV-1 infection induced autophagy, as indicated by increased levels of ATG13 and LC3-I to LC3-II conversion. Pharmacological modulation of autophagy-related pathways using rapamycin or 3-methyladenine was associated with changes in MNV-1 replication. ZFP36L1 overexpression reduced the expression of autophagy-related markers under basal conditions and following MNV-1 infection or rapamycin treatment indicating the ZFP36L1-mediated autophagy suppression contributed to a reduction in MNV-1 titer. ZFP36L1 overexpression led to reduced expression of several autophagy-related genes, including ATG13, Beclin-1, and Bcl-2, although the Beclin-1/Bcl-2 ratio remained unchanged. The decrease in ATG13 may be the reason for impaired autophagy and reduced autophagy may be one of the contributing factors to ZFP36L1-mediated norovirus suppression; however, other mechanisms such as direct interactions between ZFP36L1 and noroviral RNA still need to be investigated.

Norovirus (NoVs) are a leading cause of acute gastroenteritis worldwide. NoVs are positive-sense, non-enveloped viruses with a single-stranded RNA genome approximately 7.5 kb in size, belonging to the Caliciviridae family (1–3). The viral RNA is covalently attached to a virus-encoded nonstructural protein (VPg) at its 5′ end and a polyadenylated tail at its 3′ end (2). The VPg at the 5′ end of the viral genome acts as a protein primer for viral RNA synthesis, while the polyadenylated 3′ end enhances genome stability and promotes efficient translation (3). NoV genome encodes three overlapping open reading frames ORF1, ORF2, and ORF3 (1). ​The ORF1 region of norovirus encodes a large polyprotein that is subsequently cleaved into seven non-structural proteins (from NS1 -NS7), which includes the RNA-dependent RNA polymerase (NS7) (1). While ORF2 and ORF3 encode VP1 (Major Capsid Protein), VP2 (Minor Capsid Protein) respectively (4).

The incidence of norovirus infection is highest among young children, particularly those under five years of age, and it remains a significant cause of mortality in children in developing countries (5). Based on the amino acid sequence of the major capsid protein VP1, NoVs are classified into 10 genogroups (GI–GX) and are further categorized into polymerase and capsid genotypes (4). Among these, genogroups GI, GII, GIV, GVIII, and GIX infect humans (6). GII viruses, especially genotypes GII.4, GII.2, and GII.17 are responsible for the majority of human outbreaks (7–9). Currently, there are no approved antiviral therapies or vaccines for norovirus. Management of norovirus gastroenteritis is primarily supportive, focusing on the replacement of fluid losses and the maintenance of adequate nutritional intake to prevent dehydration (10, 11).

ZFP36L1 is a member of the tristetraprolin (TTP) protein family. These proteins are characterized by two CCCH-type zinc finger domains (ZFDs) that bind to mRNA and regulate its turnover within cells, including viral RNA (12, 13). ZFP36L1 has been studied for its diverse roles in cellular functions, including inflammation, immune system development, cell cycle regulation, metabolism and cancer (12–18). While a few studies have assessed its antiviral activity to date, its potential broad-spectrum antiviral efficacy has yet to be fully characterized (1, 12, 18–22). ZFP36L1 has demonstrated antiviral efficacy against several RNA viruses including the human coronavirus strain OC43 (HCoV-OC43) (19), flaviviruses such as Japanese encephalitis virus (JEV) and dengue virus (DENV) (1), Influenza A virus (IAV) (21), foot-and-mouth disease virus (FMDV) (20) and Crimean-Congo hemorrhagic fever (CCHF) (22).

These studies indicated that the antiviral mechanisms of ZFP36L1 can vary depending on the specific virus. For example, it promoted the decay of viral RNA by targeting the 3′-untranslated region (UTR), followed by an exosomal decay pathway, as seen with flaviviruses (12). In flaviviruses ZFP36L1-mediated removal of the poly(A) tail facilitated mRNA deadenylation, which exposed the transcript to degradation by the 5′–3′ exoribonuclease XRN1 after decapping, as well as by the 3′–5′ exoribonuclease exosome complex (12). In influenza A virus (IAV), ZFP36L1 suppresses viral protein expression and their intracellular trafficking (21). For foot-and-mouth disease virus (FMDV), ZFP36L1 inhibited viral replication by strongly binding to viral proteins such as VP3 and VP4 and suppressed virus replication (20). Similarly, interaction of the Crimean-Congo hemorrhagic fever virus (CCHFV) nucleoprotein (N) with ZFP36L1 suppressed its replication (22), these studies highlighting its potential for broad-spectrum antiviral efficacy across various virus families.

However, role of ZFP36L1 on NoVs infection has not been previously studied. The current study aims to address this knowledge gap by evaluating the potential antiviral efficacy of ZFP36L1 against norovirus infection using murine norovirus-1 (MNV-1) as other NoVs are very difficult to grown in cell culture, thereby expanding our understanding of its broader antiviral functions. Our preliminary study suggested that ZFP36L1 modulates cellular autophagy and a study with MNV-1 suggests that MNV1 infection induces autophagy to promote its replication and inhibits the final maturation of autophagosomes (23). Autophagy is a conserved cellular process responsible for the degradation and recycling of cytoplasmic components, however several viruses manipulate this pathway to facilitate different stages of their life cycle, including viral entry, replication, and the formation of membrane scaffolds for viral replication complexes (24–26). Viruses, particularly RNA viruses from diverse families including flaviviruses (JEV, DENV, Classical swine fever virus: CSFV, and Bovine viral diarrhea virus: BVDV), coronaviruses (Transmissible gastroenteritis virus: TGEV, Porcine epidemic diarrhea virus: PEDV, and Porcine deltacoronavirus: PDCoV), picornaviruses (Foot-and-mouth disease virus: FMS), orthomyxoviruses (Influenza A virus: IAV), and paramyxoviruses (Newcastle disease virus: NDV and Caprine parainfluenza virus type 3: CPIV3) induced autophagy and used autophagy to promote viral replication, as summarized in previous study (27). Mechanistically, DENV induced autophagy to promote lipid metabolism and use that energy for efficient viral replication (28). Similarly, zika virus (ZIKV) also used autophagy to facilitate its replication by exploiting host lipid metabolism (29). While Hepatitis C virus (HCV) uses autophagy for its survival and viral RNA replication (30). However, there are few contradictory studies, where autophagy can function as an important antiviral defense mechanism. For example, Herpes simplex virus 1 (HSV-1) encodes the protein ICP34.5, which inhibits autophagy to prevent degradation of viral components and ensure successful infection (31). Together, these findings highlight that viruses can induce, manipulate, or inhibit autophagy depending on the strategy that best supports their replication and survival within the host cell.

Similar to other viruses, studies on NoVs show that infection can induce autophagy, which may either promote efficient viral replication, contribute to viral restriction, or not be utilized by the virus (32). These differences may be due to variations in experimental models, host cell types, immune conditions, and differences in observation or interpretation. For example, study showed that MNV induced autophagy, and treatment with an autophagy-inducing drug such as rapamycin enhanced viral replication, indicating that autophagy may support virus replication (23), however other study supplemented with antiviral cytokines such as interferon-γ (IFN-γ) showed autophagy needed for antiviral efficacy of IFN-γ and acts as antiviral (33, 34). The collective inference from these studies suggests that, under normal conditions without additional supplementation, MNV infection induces autophagy and may utilize it to support efficient viral replication.

Taking together, our preliminary study suggested that ZFP36L1 modulates cellular autophagy. Based on these results, we hypothesized that ZFP36L1-mediated autophagy suppression may interfere with norovirus replication. The current study was designed to test this hypothesis using wild-type cells (WT), ZFP36L1-overexpressing cells, and ZFP36L1-knockdown cells, and to evaluate its effect on MNV-1 replication and autophagy.

Cell lines and virus

RAW 264.7 cells (mouse macrophage cell line, ATCC catalog number TIB-71) and HEK293T cells (human embryonic kidney cells, ATCC catalog number CRL-11268) were obtained from the American Type Culture Collection (ATCC, Manassas, VA). RAW 264.7 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 Medium, while HEK293T cells were maintained in Eagle’s Minimum Essential Medium (EMEM, Gibco BRL, Grand Island, NY). Both media were supplemented with 10% heat-inactivated fetal bovine serum (FBS) to support cell growth along with antibiotic-antimycotic solution consisting of penicillin (100 units/mL), streptomycin (0.10 mg/mL), and amphotericin B (0.25 μg/mL; Sigma-Aldrich, St. Louis, MO) to prevent bacterial and fungal contamination.

MNV-1 (ATCC, Manassas, VA) was propagated in wild-type RAW 264.7 cells to prepare the virus stock. Briefly, RAW 264.7 cells were infected with MNV-1 at a multiplicity of infection (MOI) of 0.1. After one h of adsorption, the virus inoculum was removed, and the cells were replenished with RPMI containing 10% heat-inactivated FBS and the antibiotic-antimycotic. Cells were harvested once they exhibited approximately 80% cytopathic effect. To release the virus, two cycles of freezing (-80 °C) and thawing were performed. Cell debris was removed by centrifugation at 1000 × g for 10 minutes at 4 °C, and the virus-containing supernatant was collected and titrated using TCID50 as previously described (35). The virus was aliquoted and stored at -20 °C. ​The titer of the virus stock used in the present study was 7.34 log10/mL.

Overexpression and knockdown of ZFP36L1

The overexpression and knockdown of ZFP36L1 were carried out in RAW 264.7 and HEK293T cells. For overexpression, ZFP36L1 (NCBI reference sequence: NM_001244701.1), tagged with a green fluorescent protein (GFP) marker, was stably expressed using a lentiviral vector. The ZFP36L1 gene, which includes both tandem zinc finger domains (TZFD1 and TZFD2), was cloned into a pLV-eGFP plasmid (VectorBuider, Chicago, IL). To generate the lentivirus, the pLV-eGFP plasmids containing the ZFP36L1 gene were co-transfected with VSV-G and packaging plasmids encoding Gag/Pol and Rev into HEK293T cells. After 48 hours (h), the lentiviral-containing supernatant was collected, purified, and analyzed for the presence of ZFP36L1 in the lentivirus using PCR.

For ZFP36L1 knockdown, RAW 264.7 cells or HEK293T cells were transduced with ZFP36L1-specific shRNA (GTAACAAGATGCTCAACTATA). This shRNA was stably expressed using a lentiviral vector by cloning it into a pLV-mCherry plasmid (VectorBuider, Chicago, IL). Lentivirus for ZFP36L1-shRNA was prepared as described above, by co-transfecting pLV-mCherry containing ZFP36L1 shRNA with VSV-G and packaging plasmids into HEK293T cells. Lentiviral particles carrying the scrambled shRNA construct (Vector Builder, Chicago, IL) were used as a control to assess the effect of ZFP36L1 expression on MNV-1 titer. The lentiviruses were then used to either overexpress or knock down ZFP36L1 in WT cells by transduction. For transduction, lentivirus was used at an MOI of 10 in the presence of Polybrene (Thermo Fisher Scientific, Waltham, MA) at a final concentration of 8 µg/mL. Successful transduction was verified by GFP expression for overexpression or mCherry expression for knockdown. Transduced cells were selected with increasing concentrations of puromycin (2–3 µg/mL) over 7 days. Cells with approximately 80% transduction efficiency (ZFP36L1 overexpression or knockdown) were used in the current study Selected cells were further analyzed for ZFP36L1 overexpression or knockdown using WB with ZFP36L1-specific antibodies (Thermo Fisher Scientific, Waltham, MA).

Measuring the effect of ZFP36L1 expression on murine norovirus titration

WT, ZFP36L1 overexpressed, or ZFP36L1 knockdown RAW 264.7 cells were infected with MNV-1 at 0.1 MOI. The supernatant from these cells was collected at 6 h, 12 h, 24 h, and 36 h post-infection (p.i.). Collected cell supernatants were then centrifuged at 1000 × g at 4 °C for 15 min to remove cell debris and stored at −80 °C until used. Once samples from all-time points were collected, the MNV-1 virus titer was determined using TCID50 as the method described earlier (35). Changes in virus titer in ZFP36L1 overexpressed or ZFP36L1 knockdown cells as compared to wild-type cells were statistically analyzed using a paired T-test with a 95% confidence level. Similarly, to assess the effects of autophagy modulation on MNV-1 titers, WT cells were treated with the autophagy-enhancing drug rapamycin or the autophagy-inhibiting drug 3-methyladenine (3-MA). Cell supernatants were collected at 6 h, 12 h, and 24 h post-infection (p.i.), and virus titers were determined using TCID50. Titer results were analyzed by paired T-test with a 95% confidence level.

Overexpression of microtubule-associated protein 1 light chain 3 beta

LC3 expressing lentivirus plasmid (FUGW-PK-hLC3, Addgene, Watertown, MA) with mCherry marker was used to transfect HEK293T cells using Lipofectamine 3000 (Invitrogen, Waltham, MA). Overexpression of LC3 was measured by red fluorescence and confirmed by WB analysis using LC3B antibody (clone D11, 1:1000, Cell Signaling Technology, Danvers, MA). Cells treated with Lipofectamine 3000 alone served as a control.

Western blotting

To confirm the overexpression or knockdown of ZFP36L1, LC3 overexpression, LC3I- LC3II conversion or to measure the effect of ZFP36L1 overexpression or knockdown on LC3, LC3I- LC3II conversion, p62/SQSTM1 or ATG13. WT, ZFP36L1-overexpressed, ZFP36L1-knockdown cells (eg. HEK293T cells, or RAW 264.7 cells), or WT and LC3-overexpressing HEK293T cells were plated in 6 well plates. After 24 h, cells were lysed using radioimmunoprecipitation assay buffer (RIPA buffer) (catalog number 9806, Cell Signaling Technology, Danvers, MA), supplemented with protease-phosphatase inhibitors (catalog number 5872, Cell Signaling Technology, Danvers, MA). The lysates were centrifuged at 3,000 × g for 15 minutes at 4 °C, and the supernatant was collected. Protein concentrations were determined using the Pierce™ BCA Protein Assay Kit (catalog number 23225, ThermoFisher Scientific, Waltham, MA, USA). A 40 µg of cell lysates were separated by 12% SDS-PAGE, then transferred to a polyvinylidene difluoride (PVDF) membrane (catalog number 88518, ThermoFisher Scientific, Waltham, MA, USA). The membrane was blocked with 5% skimmed milk (catalog number 1.15363, Sigma-Aldrich, St. Louis, MO, USA) in Tris-buffered saline (TBS) for 1 h at room temperature and incubated overnight at 4 °C with anti-ZFP36L1 antibody (catalog number PA527445, 1:1000, ThermoFisher Scientific, Waltham, MA), anti-LC3B (clone D11, 1:1000, Cell Signaling Technology, Danvers, MA), anti-p62/SQSTM1 antibody (Catalog number 5114, 1:1000, Cell Signaling Technology, Danvers, MA), anti-ATG13 antibody (clone number D4P1K, 1:1000, Cell Signaling Technology, Danvers, MA), with anti-β-actin antibody (Clone number 2D1D10, 1:4000, GenScript USA Inc, Piscataway, NJ). Combined antibody information is summarized in Supplementary Table 1.

After incubation, the membranes were washed three times with TBS + 0.1% Tween 20 (TBST) and incubated with HRP-conjugated secondary antibodies (1:2000) for 1 h at room temperature. Following washes, the membranes were developed using the Pierce ECL Western Blotting Substrate (catalog number 32109, Thermo Fisher Scientific, Waltham, MA). Western blot (WB) images were captured using the Odyssey XF Imaging System (LI-COR Biosciences, Lincoln, NE). Band intensities for the proteins were normalized to β-actin using ImageJ software (36).

Similarly, to measure the effect of ZFP36L1 overexpression on MNV-1-induced autophagy, or drug induced-autophagy (eg. following treatment with the autophagy-inducing drug rapamycin or the autophagy-inhibiting drug 3MA), cells were collected 24 h p.i. or treatment. The samples collected were then analyzed for LC3-II/LC3-I ratio, ZFP36L1 expression using the WB method described above. The change in expression of LC3II/LC3I ratio in ZFP36L1-overexpressing, ZFP36L1 knockdown, or drug-treated cells (e.g., 3MA or rapamycin) was compared to WT control cells were analyzed using two-way ANOVA.

Autophagy modulation

Autophagy modulation in RAW 264.7 cells or HEK293T cells were carried out using autophagy inhibiting drug, 3MA (catalog number 13242, Cayman Chemicals, Ann Arbor, MI) or autophagy enhancing drug, rapamycin (catalog number 13346, Cayman Chemicals, Ann Arbor, MI). Doses for 3MA (2 μM/mL, 4 μM/mL, and 10 μM/m) and rapamycin (10 nM/mL, 20 nM/mL, and 40 nM/mL) were titrated for their maximum effect on autophagy modulation using LC3B expression (37) while the minimum effect on cell viability. Cell viability was measured using the trypan blue exclusion assay (38). The details of drug titration are provided in Supplementary File 1. The current study used 3-MA at a concentration of 4 µM and rapamycin at 20 nM to suppress and enhance autophagy, respectively.

RNA isolation and quantitative PCR for ZFP36L1 and autophagy genes

The qPCR was performed to measure the interrelation between ZFP36L1, MNV-1 infection, and autophagy. ZFP36L1-overexpressing, ZFP36L1 knockdown or WT HEK293T cells/RAW 264.7 cells or WT HEK293T cells treated with autophagy-modulating drugs such as 3MA or rapamycin; or RAW 264.7 cells infected with MNV-1 (0.1 MOI) along with mock-infected RAW 264.7 cells were collected at 6 h or 12 h post seeding, or p.i.

Total RNA was isolated from these cells using the Monarch Total RNA Miniprep Kit (catalog number T2010S, New England Biolabs, Ipswich, MA). RNA concentration was measured using the BioTek Synergy LX multi-mode reader (BioTek Instruments Inc, Winooski, VT) and normalized to ensure equal RNA concentration across samples. qPCR for the quantification of autophagy genes such as LC3B, ATG13, ULK1, Beclin-1, Bcl-2 as well as ZFP36L1 was performed using the Power Track SYBR Green (catalog number A46109, ThermoFisher Scientific, Waltham, MA) and Stratagene MX3000P Real-Time Thermocycler (Stratagene Inc., La Jolla, CA, USA). Primer sequences used in the current study are summarized in Supplementary Table 2. The qPCR were performed in 10 µl reaction with amplification cycle at 95 °C for2 minutes, 40 cycles of (95 °C for15 seconds and 60 °C for 1 minute) and melting curve cycle at: 95 °C for 15 seconds, 60 °C for 1 minute and 95 °C for 15 seconds. The CT values were normalized to GAPDH as an internal control, and the fold change in gene expression was calculated using the 2^(-ΔΔCT) method, with the control sample used as the reference and assigned a value of 1.

Statistical analysis

The average of each experimental dataset was calculated using Microsoft Excel. The bar graphs in the current manuscript show the mean values with error bars (SEM). For statistical analysis, the effects of lentiviral transduction on ZFP36L1 overexpression or knockdown, the effect of ZFP36L1 expression on MNV-1 titer and autophagy-related genes, the effect of autophagy on ZFP36L1 expression, and the effect of MNV-1 on autophagy were analyzed using a two-tailed Student’s t-test at a 95% confidence level in Microsoft Excel. While the effect of ZFP36L1 overexpression on basal, drug-induced, or MNV-1–induced autophagy was evaluated using one-way ANOVA at a 90% and 95% confidence level in GraphPad Prism 10 software.

Overexpression of ZFP36L1 significantly suppressed MNV-1 titer

To evaluate the effect of ZFP36L1 on MNV-1 replication, the current study used WT, ZFP36L1-overexpressing, and ZFP36L1-knockdown RAW 264.7 cells. RAW 264.7 cells transduced with scrambled shRNA (Src shRNA) served as an additional control for the knockdown experiments. WB analysis showed that ZFP36L1-overexpressing cells had approximately 2.8 ± 0.67-fold higher expression of ZFP36L1 compared with control cells. Whereas ZFP36L1-knockdown cells showed reduced expression (~0.51 ± 0.10-fold, corresponding to ~0.49-fold lower) relative to control cells. While Cells expressing Src shRNA showed similar ZFP36L1 expression (~0.85 ± 0.18) compared with control cells (Supplementary Figure 1). Cells were infected with MNV-1 at a MOI of 0.1, and supernatants were collected at 0, 6-, 12-, 24-, and 36 h p.i. for virus titration. Our results showed that ZFP36L1 overexpression significantly suppressed MNV-1 titers as well as virus induced cytopathic effect (Supplementary Figure 2) while ZFP36L1 knockdown significantly enhanced MNV-1 titers (Figure 1D, Table 1).

Virus titer reduction in ZFP36L1 overexpressed cells was observed as ~1 log10/mL, ~ 1.9 log10/mL, and ~ 3 log10/mL lower as compared to WT cells at 12 h, 24 h, and 36 h p.i., respectively. While in ZFP36L1 knockdown cells, virus titer was ~1 log10/mL, ~1 log10/mL and ~2 log10/mL higher as compared to WT cells at 12 h, 24 h, and 36 h p.i., respectively (Table 1, Figure 1). While change in ZFP36L1 expression by Src shRNA did not have any effect on virus titer as compared to WT control cells. These results showed that ZFP36L1 interferes with MNV-1 replication and overexpression of ZFP36L1 reduces MNV-1 titer.

MNV-1 infection increased the expression of autophagy-related genes and markers

To determine whether MNV-1 induced autophagy and utilizes the autophagy machinery for its efficient replication, RAW 264.7 cells were infected with MNV-1 at a MOI of 0.1. Total RNA was collected at 6- and 12-h p.i. and analyzed for autophagy markers microtubule-associated protein 1 light chain 3 (LC3I) (39) and Autophagy-related protein 13 (ATG13) (40) using qPCR. In a separate experiment, total protein was collected from MNV-1 (MOI: 0.01)-infected RAW 264.7 cells d at 24 h p.i. was analyzed for MNV-1 capsid protein, and LC3-II/LC3-I ratio using WB. Results showed that MNV-1 infection significantly increased autophagy-related markers (p<0.05) (Figure 2). Expression of LC3 significantly increased 4259.05± 282.30 (~3.63 log10) and 3.85 ± 0.34 folds as compared to uninfected control cells (1.04 ± 0.20 and 1.36 ± 0.35 folds) at 6 h and 12 h p.i., respectively (p<0.05) (Figure 2A). Similarly, ATG13 expression increased 12174.92 ± 1226.58 (~4.09log10) and 3.93 ± 0.82 fold as compared to uninfected control cells (1.09 ± 0.28 and 1.17 ± 0.34) at 6 hand 12 h p.i., respectively (p<0.05) (Figure 2B). WB results showed that MNV-1 infection significantly increased LC3-II/LC3-I ratio (p < 0.05) (Figures 2C, D). The LC3-II/LC3-I ratio in MNV-1-infected cells was 7.18 ± 0.26, compared to 1.00 ± 0.44 in mock-infected cells (Figures 2C, D).

To further analyze whether MNV-1 uses the autophagy mechanisms for its efficient replication, we pre-treated the RAW 264.7 cells with autophagy-inducing drug, rapamycin (20 nM) or autophagy inhibiting drug, 3MA (4µM) and infected with MNV-1. Virus titer was analyzed at 6 h, 12 h and 24 hr p.i. Results showed that the autophagy-inducing drug, rapamycin significantly increased MNV-1 titer at later time points (12- and 24-h p.i.) while autophagy inhibiting drug, 3 MA significantly suppressed virus titer at the early time point (e.g. 6 h p.i.) (Figure 3). MNV-1 titer in rapamycin-treated cells was 1.54 ± 0.04 log10/mL, 2.96 ± 0.04 log10/mL and 6.99 ± 0.04 log10/mL at 6 h., 12 h and 24 h p.i as compared to mock treated-MNV-1 infected control cells which showed virus titer as 1.46 ± 0.04 log10/mL, 2.40 ± 0.26 log10/mL, 6.01 ± 0.08 log10/mL at 6 h, 12 h and 24 h p.i. MNV-1 titer in rapamycin-treated cells at 12 h p.i and 24 h p.i was ~ 0.5 log10/mL and ~1 log10/mL higher than mock-treated-MNV-1 infected cells.

MNV-1 titer in 3MA-treated cells was reported as 0.79 ± 0.05 log10/mL, 2.51 ± 0.08 log10/mL, and 5.97 ± 0.0.06 log10/mL at 6 h, 12 h, and 24 h p.i., respectively (Figure 3). At 6 h p.i., virus titer in 3MA-treated cells was ~0.67 log10/mL lower than in mock-treated-MNV-1 infected cells. These results indicate that MNV-1 uses autophagy machinery for its efficient replication.

ZFP36L1 overexpression reduced the expression of autophagy-related markers under basal conditions and following rapamycin treatment or MNV-1 infection

Rapamycin is an autophagy-inducing drug (41). It enhances autophagy by suppressing mTOR complex 1 (mTORC1). Normally, mTORC1 inhibits the ULK1-ATG13-FIP200 complex, which is essential for autophagy initiation. Inhibition of mTORC1 activates ULK1 (UNC-51-like kinase 1), which then phosphorylates downstream autophagy-related proteins, leading to autophagosome formation (42). To determine if ZFP36L1 suppresses rapamycin-induced autophagy, current study used WT, ZFP36L1-overexpressing and ZFP36L1 knockdown RAW 264.7 cells. These cells were treated with autophagy-inducing drug rapamycin while mock-treated cells were used as controls. Total protein was collected at 24 h post-treatment to measure the effects of ZFP36L1 on autophagy (43). The collected proteins were analyzed for LC3II/LC31 ratio. Results showed that ZFP36L1 overexpression significantly suppressed the rapamycin-induced (p<0.05) as well as basal autophagy (p<0.1)(Figure 4A).

The LC3II/LC3I ratio in rapamycin-treated ZFP36L1-overexpressing cells was 0.46 ± 0.05, while rapamycin-treated WT cells had an LC3II/LC3I ratio of 1.57 ± 0.16, compared to mock-treated WT RAW 264.7 cells, which had an LC3II/LC3I ratio of 0.90 ± 0.01 (Figure 4A). Mock-treated ZFP36L1-overexpressing cells had a significantly lower LC3II/LC3I ratio (0.56 ± 0.08) compared to mock-treated WT cells (0.90 ± 0.01) (p<0.1) (Figure 4A), indicating that ZFP36L1 also lowers basal autophagy in cells. Similarly, qPCR analysis showed that ZFP36L1 suppressed MNV-1-induced autophagy (Figure 4C). The qPCR analysis showed that MNV-1 infection significantly increased LC3 expression, with a 3.82 ± 0.16-fold increase compared to mock-infected cells, which had an expression level of 1.02 ± 0.11-fold. In contrast, ZFP36L1 overexpression significantly reduced LC3 expression from 3.82 ± 0.16-fold to 1.32 ± 0.20-fold (P<0.05) (Figure 4C). WB analysis of the LC3-II/LC3-I ratio in MNV-1–infected WT RAW 264.7 cells and MNV-1–infected ZFP36L1-overexpressing RAW 264.7 cells showed similar results, indicating that ZFP36L1 overexpression suppressed MNV-1–induced autophagy (p<0.05) (Figure 4B).

ZFP36L1 overexpression suppressed autophagy in HEK293T cells

This study also explored the relationship between ZFP36L1 and cellular autophagy using human cells (HEK293T cells), given that NoVs poses a significant health problem in humans. To assess the impact of ZFP36L1 on autophagy, total protein was collected from stably ZFP36L1-overexpressing, ZFP36L1-knockdown and WT HEK293T cells. Autophagy was analyzed by LC3-II/LC3-I ratios using WB. Our result showed that ZFP36L1 overexpression significantly suppressed the LC3-II/LC3-I ratios (p<0.05) (Figures 5A, B). The LC3-II/LC3-I ratio in ZFP36L1-overexpressing HEK293T cells was 0.39 ± 0.15 compared to WT control cells (1.00 ± 0.20) (Figures 5B, C), indicating that ZFP36L1 overexpression reduced the expression of autophagy-related markers in both human and murine cells.

Overexpression of LC3B did not influenced ZFP36L1 expression

To further investigate whether LC3B overexpression affects ZFP36L1 expression. HEK293T cells were overexpressed with LC3B using a plasmid FUGW-PK-hLC3 plasmid. LC3B overexpressed or WT control HEK293T cells was collected at 24 h post-transfection and analyzed for ZFP36L1 expression. Native LC3B overexpression was confirmed by WB, with LC3B-overexpressed cells showing a 4.41 ± 0.46-fold higher LC3B/β actin ratio (higher LC3B) expression compared to control cells which showed LC3B/β actin ratio as 1.00 ± 0.30 (Figures 5C, E). Results showed that there was no effect of LC3 expression on ZFP36L1 (Figures 5D, E). The ZFP36L1/β-actin ratio in LC3B-overexpressed cells was 1.00 ± 0.13, which was not significantly different from the ZFP36L1/β-actin ratio in WT cells (1.00 ± 0.34) (p>0.05) (Figure 5D).

Overexpression of ZFP36L1 suppressed autophagy-related protein 13 expression

To identify the pathways by which ZFP36L1 suppresses autophagy, the current study examined the effect of ZFP36L1 overexpression and ZFP36L1 knockdown on ULK1 and ATG13 expression using qPCR and WB. ULK1 is a central regulator of autophagy initiation, forming the ULK1-ATG13-FIP200-ATG101 complex that orchestrates autophagosome formation (44). Total RNA was isolated from ZFP36L1-overexpressing, ZFP36L1-knockdown and WT HEK293T cells and analyzed for ULK1 and ATG13 expression. Results showed that ZFP36L1 overexpression significantly suppressed ATG13 expression but had no effect on ULK1 expression (p<0.05) (Figures 6A, C), Similarly ZFP36L1-knockdown did not have any effect of ATG13 or ULK1 expression (Figures 6A, C). The relative ATG13 expression in ZFP36L1-overexpressing cells was 0.49 ± 0.11 compared to WT cells (1.22 ± 0.31) (Figure 6A). In contrast, the relative expression of ULK1 in ZFP36L1-overexpressing cells was 0.97 ± 0.23 which was not significantly different compared to WT cells (1.01 ± 0.31) (Figure 6C). Suppression of ATG13 expression in ZFP36L1-overexpressing cells was further confirmed by WB. Total protein isolated from the above experimental setup was analyzed for ATG13 and β-actin expression using WB. The ATG13/β-actin ratio in ZFP36L1-overexpressing cells was 0.29 ± 0.08, which was significantly lower than that in WT control cells (1.00 ± 0.14; p < 0.05), However, ZFP36L1 knockdown did not have a significant effect on ATG13 expression compared to the control (p<0.05) (Figure 6B, D). These findings indicate that ZFP36L1 suppresses autophagy initiation by affecting the ULK1 complex by inhibiting ATG13 expression.

Overexpression of ZFP36L1 suppressed beclin-1 and BcL-2 expression

To investigate whether ZFP36L1 also impacts mTOR-independent pathways in suppressing autophagy, the current study examined its effect on Beclin-1 and B-cell lymphoma 2 (BcL-2) expression. Beclin-1 forms a complex with Phosphoinositide 3-Kinase, Class III (PI3K or PIK3C3), ATG14, and UV radiation resistance-associated gene (UVRAG), which is essential for autophagosome formation (45). Total RNA was isolated from ZFP36L1 overexpressed, ZFP36L1 knockdown and WT HEK293T cells and analyzed for Beclin-1 and BcL-2 expression to estimate Beclin-1/BcL-2 ratio. Our results showed that ZFP36L1 overexpression significantly suppressed the Beclin-1 and BcL-2 expression (p<0.05) (Figure 6E). While knockdown of ZFP36L1 did not affect the expression of Beclin-1 or Bcl-2. The relative Beclin-1 expression in ZFP36L1 overexpressed was 0.27 ± 0.15 which was significant lower as compared to WT cells (0.93 ± 0.21) (p<0.05). The relative Beclin-1 which was not significantly different in ZFP36L1 knockdown cells as compared to control cells.

The relative expression of BcL-2 in ZFP36L1-overexpressing cells was significantly lower (0.09 ± 0.03) compared to WT cells (1.80 ± 0.61) (p < 0.05), whereas its expression in ZFP36L1 knockdown cells (1.17 ± 0.25) was not significantly different from control cells. Further analysis showed that ZFP36L1 had no significant effect on the Beclin-1/BCL-2 ratio. The Beclin-1/BCL-2 ratio in ZFP36L1-overexpressing cells (2.77 ± 1.28) was not significantly different from that in WT cells (1.63 ± 0.84). Similarly, Beclin-1/BcL-2 ratio in ZFP36L1 knockdown cells was observed as 0.95 ± 0.14 which was also not significant different from WT cells.

ZFP36L1 overexpression enhances p62 expression

p62 (SQSTM1) is commonly used as a marker associated with autophagy because it is degraded during autophagic processing, and changes in its protein levels can reflect alterations in autophagy-related pathways (46). In the current study, we also examined the effect of ZFP36L1 expression on p62 levels. Total protein was isolated from ZFP36L1-overexpressing, ZFP36L1-knockdown, and WT cells and analyzed for p62/SQSTM1 expression by WB blot. Our results showed that ZFP36L1 overexpression significantly increased p62/SQSTM1 expression (p < 0.05) while knockdown of ZFP36L1 did not have any effect on p62/SQSTM1 expression. ZFP36L1-overexpressing cells had p62/β-actin ratios as 1.80± 0.0.36 which was significantly higher as compared to the control (1.00 ± 0.19). The p62 expression (eg. p62/β-actin ratios) in ZFP36L1-knockdown cells was non-significant different (1.18 ± 0.47) as compared to control (1.00 ± 0.19) (Figure 6F).

MNV-1 significantly suppressed ZFP36L1 expression in virus-infected cells

So far, our study has shown that ZFP36L1 suppressed MNV-1 replication. To determine the effect of MNV-1 on ZFP36L1 expression in host cells, total RNA from mock- or MNV-1–infected RAW 264.7 cells was analyzed for ZFP36L1 expression using qPCR. Our results showed that MNV-1 significantly suppressed ZFP36L1 expression (Figure 7), indicating a complex interaction between MNV-1 and host cells. ZFP36L1, a host RNA-binding protein known to regulate transcript stability and turnover of genes including viral and autophagy gene (according to current manuscript findings). Suppression of ZFP36L1 by MNV-1 therefore suggests a viral strategy to modulate host regulation and its efficient replication. Results of current study showed a relative ZFP36L1 expression in MNV-1 infected cells as 0.02 ± 0.00 as compared to mock infected cells (1.07 ± 0.18) which was significant lower at 5% level of significance.

The current study was carried out to evaluate the effect of ZFP36L1 on NoVs replication using MNV-1 as a surrogate model. Our results showed that overexpression of ZFP36L1 significantly suppressed the MNV-1 titer while its knockdown significantly enhanced the MNV-1 titer. These results highlight the antiviral efficacy of ZFP36L1, underscoring its critical role as a host antiviral factor. The antiviral activity of ZFP36L1 has been previously demonstrated against other viruses, including flaviviruses such as JEV and DENV (12), IAV (21), HCoV-OC43 (19) and FMDV (20). The underlying antiviral mechanisms of ZFP36L1 vary depending on the specific virus. Additionally, ZFP36L1 impairs the nuclear export of viral ribonucleoproteins (vRNPs), a process essential for viral assembly and replication, by blocking the translation of the IAV nonstructural protein 2 (NS2) and matrix protein 1 (M1), thus reduced viral replication (21). These findings revealed the multifaceted role of ZFP36L1 in disrupting IAV replication through post-transcriptional regulatory mechanisms. Our preliminary findings showed that ZFP36L1 exhibited a strong binding affinity to the N transcript of HCoV-OC43, thereby suppressed its replication. ZFP36L1 facilitated the degradation of FMDV structural proteins VP3 and VP4 through its CCCH-type zinc finger and nuclear export signal (NES) domains, thus reduced viral replication (20).

Autophagy is a critical component of the innate immune system that aids in eliminating pathogens, including viruses (47, 48). However, many viruses, particularly RNA viruses, have evolved mechanisms to hijack autophagic machinery for their efficient replication (49, 50). Previous study suggested that MNV induced autophagy and utilizes autophagic machinery for its efficient replication but prevents final autophagosome maturation (23). The current study investigates whether ZFP36L1 suppressed MNV-1 replication by modulating autophagy. Our study showed that MNV-1 infection increased the expression of autophagy-related genes and markers. RAW 264.7 cells infected with MNV-1 showed a significant increase in the expression of autophagy-related genes such as LC3 and ATG13 with increased LC3I to LC3II coversion. These results corroborate with previous studies indicating that MNV-1 infection triggers a robust autophagic response (23, 32).

To further examine whether NoVs utilizes autophagic machinery for its efficient replication, we treated MNV-1-infected RAW 264.7 cells with the autophagy-inducing drug rapamycin and the autophagy-inhibiting drug 3MA. The results revealed that 3MA significantly suppressed MNV-1 replication while rapamycin enhanced the viral replication. Similar to our results, earlier studies have shown that MNV induces autophagy, and that autophagy induction by rapamycin in virus-infected cells increases both intracellular and extracellular virus levels (39). MNV replicates on membranous structures in the cytoplasm known as replication complexes (RCs). Study showed that these RCs are marked by the LC3 conjugation system and are subsequently targeted by immunity-related GTPases (IRGs) and guanylate-binding proteins (GBPs) following their induction by IFNγ (51). Another study further demonstrated that autophagy-related proteins, such as the ATG5-ATG12/ATG16L1 complex, assist IFNγ in suppressing MNV-1 replication by blocking the formation of the membranous cytoplasmic MNV replication complex (52).

Our results indicate that pharmacological modulation of autophagy-related pathways using rapamycin and 3-MA was associated with changes in MNV-1 replication, suggesting that cellular pathways linked to autophagy may influence MNV-1replication. In continuation, the current study demonstrated that overexpression of ZFP36L1 significantly suppressed autophagy under basal conditions, as well as in response to rapamycin treatment and MNV-1 infection. These findings suggest that ZFP36L1 appears to negatively regulate the expression of autophagy-related genes and markers under both physiological and stress-induced conditions.

The current study utilized multiple cell lines, including human embryonic kidney (HEK293T) cells and murine macrophage RAW 264.7 cells, to assess the role of ZFP36L1. Across both human and murine models, ZFP36L1 overexpression consistently led to a significant suppression of autophagy. These findings highlight the conserved nature of ZFP36L1’s regulatory effect on autophagy across species and cell types.

To determine the relationship between ZFP36L1 and autophagy, the current study first overexpressed and knockdown ZFP36L1 and assessed its effect on autophagy by WB and qPCR using specific primers.

Results showed that overexpression of ZFP36L1 significantly suppressed LC3II/LC3I ratio. Results also showed that ZFP36L1 overexpression did not have any effect on ULK1 expression, but it significantly reduced in ATG13 expression. ULK1 is a key component in the initiation of autophagy. It forms the ULK1-ATG13 complex, consisting of ULK1, ATG13, the 200 kDa FAK family kinase interacting protein (FIP200), and ATG101 (53). ATG13 and ATG101 contain the HORMA domain (Hop/Rev7/Mad2) which is essential for protein-protein interactions and regulates the scaffolding ULK1-ATG13 complex (54). Suppression of ATG13 would prevent the full assembly or function of the ULK1 complex, thereby inhibiting the initiation of autophagy. Further studies are needed to determine the role of ZFP36L1 on ATG101 and its potential effect on the phosphorylation of ULK1 or ATG13 (55).

Current study also investigated the effect of ZFP36L1 on the downstream molecules of ULK1 or mTOR-independent pathways in suppressing autophagy. Specifically, measured the expression of Beclin-1 and BcL-2 in ZFP36L1-overexpressing and WT HEK293T cells. Beclin-1 is a core component of the class III phosphatidylinositol 3-kinase (PI3K-III) complex. It modulates the lipid kinase activity of the PI3K-III catalytic unit VPS34, which generates phosphatidylinositol 3-phosphate (PI3P). PI3P then recruits other autophagy proteins, such as WIPI2 (WD-repeat protein interacting with phosphoinositides), DFCP1 (double FYVE-containing protein 1) and ATG18, which are involved in the nucleation of the autophagosome (51, 56, 57), therefore a reduction in Beclin-1 transcript would suppress autophagosome nucleation or autophagy initiation. Bcl-2, which plays a critical role in maintaining cellular homeostasis by balancing survival and death signals, it directly binds to Beclin-1 via its BH3 domain. This prevents Beclin-1 from participating in the PI3K-III complex, which is required for autophagy initiation, thereby suppressing autophagy (58). Our results showed that Beclin-1 and Bcl-2 were significantly reduced in ZFP36L1-overexpressing cells as compared to WT control cells. This finding aligns with previous studies demonstrating ZFP36L1 overexpression suppressed Bcl-2 transcripts through the 3’ UTR degradation pathway (59). However, suppression of Bcl-2 transcripts alone could not act independently; it works in close association with Beclin-1. Beclin-1, a pro-autophagy marker, and Bcl-2, an anti-autophagy marker, are reduced, the Beclin-1/Bcl-2 ratio serves as a more reliable indicator to assess their overall effect on autophagy, as demonstrated in previous studies (60, 61). The current study showed that ZFP36L1 overexpression did not affect Beclin-1/Bcl-2 ratio compared to WT cells, indicating that ZFP36L1-mediated autophagy suppression is more likely regulated through alternative pathways independent of Beclin-1 and Bcl-2.

To further investigate the relationship between ZFP36L1 and autophagy, autophagy was modulated using the autophagy-enhancing drug rapamycin and the autophagy-suppressing drug 3MA. ZFP36L1 expression was then measured by WB. Results showed that neither the autophagy-suppressing drug 3MA nor the autophagy-enhancing drug rapamycin had any effect on ZFP36L1 expression. We confirmed the effect of enhanced on ZFP36L1 expression by overexpressing LC3B in HEK293T cells using the LC3B plasmid (e.g., FUGW-PK-hLC3) (41). Again, HEK293T cells overexpressing LC3B showed no change in ZFP36L1 expression, as measured by WB.

Together, these data indicate that ZFP36L1 overexpression reduces the expression of autophagy-related genes such as ATG13 and LC3B. In contrast, neither pharmacological nor genetic modulation of autophagy altered ZFP36L1 expression; therefore, these findings suggest that ZFP36L1 functions upstream of the autophagy pathway. A potential relationship between ZFP36L1 and the autophagy pathway is represented in Supplementary Figure 3.

To further clarify the mechanism, our future studies will include autophagy flux assays such as bafilomycin A1 or chloroquine treatment to block lysosomal degradation, combined with LC3 turnover assays, p62 analysis and mCherry-GFP-LC3 reporter imaging, to distinguish between changes in autophagosome formation versus degradation in WT, ZFP36L1 overexpressed, ZFP36L1 knockdown cells and scrambled shRNA–transduced cells. These assays will be coupled with MNV infection and autophagy gene transcript analysis to confirm that ZFP36L1-mediated inhibition of autophagy initiation is responsible for the observed suppression of viral titers along with RNA immunoprecipitation (RIP) to measure ZFP36L1- viral/cellular transcript interaction. Additionally, future experiments will be useful by overexpressing ATG13 in ZFP36L1-overexpressing cells and measuring whether ZFP36L1-mediated effects on autophagy can be rescued.

Results of the current study also showed that MNV-1 infection significantly suppressed ZFP36L1 expression, indicating a complex interaction between the virus and host cells. The suppression in ZFP36L1 suggests a viral strategy to modulate host regulation and promote efficient viral replication. ZFP36L1 is an RNA-binding protein that recognizes specific motifs, namely AU-rich elements (AREs), particularly the AUUUA sequence in mRNA), which typically mediates mRNA destabilization and degradation. Genomic analysis of MNV-1 showed that its ORF1 contains four AUUUA motifs (positions 2257–2261, 2490–2494, 3860–3864, and 4023–4027) (Supplementary File 2). These AUUUA sequences are well-characterized targets of ZFP36L1. Since ORF1 encodes essential viral proteins required for replication, including the viral protease and RNA-dependent RNA polymerase (RdRp), binding of ZFP36L1 to these AREs may directly interfere with viral gene expression and replication. ZFP36L1 knockdown could disrupts the function of endogenous ZFP36L1, and this loss of restriction may contribute to the enhanced viral titer observed in knockdown cells.

In summary, the findings of the current study revealed that ZFP36L1 is a critical regulator of both autophagy and MNV-1 replication. ZFP36L1 overexpression suppressed MNV-1 replication by suppressing ATG13, LC3 and Beclin-1 transcripts, though ZFP36L1 may use additional pathways in suppressing MNV-1, which requires further investigation. Future investigations should also include the underlying mechanisms through which ZFP36L1 suppresses autophagy-related genes.