Skip to content
Frontiers
Search

Original Research

Frontiers in Parasitology ·

Volume 5 - 2026 | https://doi.org/10.3389/fpara.2026.1860216

Molecular detection of Giardia duodenalis and the absence of Cryptosporidium spp. in owned dogs from Central Vietnam

  • Vy Thi Tuong Le1
  • Minh-Trang Thi Hoang1,2
  • Van-Phuong Ngo3
  • Dinh Ng-Nguyen4
  • Tawin Inpankaew1*corresponding author
  1. 1Department of Parasitology, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand
  2. 2Department of Microbiology and Parasitology, Buon Ma Thuot Medical University, Buon Ma Thuot, Dak Lak, Vietnam
  3. 3Department of Basic Sciences, Buon Ma Thuot Medical University, Buon Ma Thuot, Dak Lak, Vietnam
  4. 4Department of Veterinary Medicine, Faculty of Agriculture, Tay Nguyen University, Buon Ma Thuot, Dak Lak, Vietnam
Article metrics0 viewsView details
PDFCiteMetrics

Abstract

Giardia duodenalis and Cryptosporidium spp. are ubiquitous enteric protozoans of significant public health and veterinary concern. Despite their global importance, molecular epidemiological data concerning companion animals in Vietnam remain limited. This cross-sectional study evaluated the prevalence, investigated the specific Giardia assemblages and Cryptosporidium species, and identified risk factors associated with these parasites in 362 owned dogs in Dak Lak province, Central Vietnam. Genomic DNA extracted from fecal samples was screened using nested PCR targeting the small subunit ribosomal RNA (SSU rRNA) locus, followed by sequencing of positive amplicons. Epidemiological risk factors were assessed using multivariable logistic regression. The overall prevalence of G. duodenalis was 8.0% (29/362; 95% confidence interval [CI]: 5.6–11.3%), whereas Cryptosporidium spp. DNA was not detected. Sequencing of 18 Giardia -positive isolates exclusively identified the canine-specific assemblage D. Multivariable analysis revealed that direct contact with other dogs (adjusted odds ratio [aOR] = 7.55; 95% CI: 1.69–33.82; P = 0.008) and unbathed status (aOR = 0.30; 95% CI: 0.11–0.83; P = 0.021) were significant predictors of infection. Host demographics, location, outdoor access, and deworming history had no significant association with Giardia positivity. The exclusive detection of assemblage D indicates that dogs in this rural setting currently pose a minimal direct zoonotic risk to the local human population. These findings emphasize the importance of improving canine management practices, particularly through proper hygiene and the restriction of uncontrolled interactions between dogs, to mitigate transmission risks.

Keywords

1 Introduction

Giardia duodenalis and Cryptosporidium spp. are ubiquitous foodborne and waterborne protozoan parasites that represent a significant contemporary public health concern (Erickson and Ortega, 2006; Sun et al., 2023). These pathogens inhabit the gastrointestinal tract and are frequently reported causes of diarrhea in humans and various vertebrate hosts (de Lucio et al., 2017; Li et al., 2019; Smith et al., 2020; Yun et al., 2024). Both parasites have a direct life cycle, with transmission occurring via the fecal-oral route, either through direct contact with infected hosts or indirectly via the consumption of food and water contaminated with infective stages (cysts for G. duodenalis and oocysts for Cryptosporidium spp.) (Agresti et al., 2022; Santin, 2020). These cysts and oocysts are infective immediately upon shedding in feces, are highly persistent in the environment, and require a low infectious dose (Barbosa et al., 2023; Simonato et al., 2017; Sykes, 2023).

G. duodenalis and Cryptosporidium spp. are among the most common protozoan parasites reported in dogs worldwide (Liao et al., 2020). The worldwide prevalence of G. duodenalis in dogs is estimated at 15.6% (Sun et al., 2023), which is notably higher than the 6.0% prevalence of Cryptosporidium spp. estimated via molecular diagnostic methods (Taghipour et al., 2020). Symptoms of Giardia infection in dogs mainly include acute or chronic intermittent diarrhea; however, the infection is often subclinical, especially in adult animals (Rana, 2024; Sykes, 2023). Canine cryptosporidiosis ranges from asymptomatic to severe diarrhea (Yun et al., 2024), with weight loss and malabsorption more frequently observed in young or immunocompromised dogs (Saari et al., 2019).

Given the rising canine population and the close contact between pets and owners, the zoonotic transmission of these infections is a critical One Health consideration (Adell-Aledón et al., 2018; Barbosa et al., 2023). Globally, G. duodenalis and Cryptosporidium spp. impose a significant public health burden, with estimated human prevalence rates of 9.7% and 7.6%, respectively (Dong et al., 2020; Sun et al., 2023). Although infections are frequently asymptomatic, they can precipitate severe, life-threatening complications in immunocompromised individuals (Santin, 2020; Szydłowicz et al., 2024).

Both parasites exhibit extensive genetic diversity, resulting in varying zoonotic implications (Li et al., 2025). G. duodenalis is classified into eight assemblages (A–H), and humans are primarily infected by the zoonotic assemblages A and B (Adell-Aledón et al., 2018; Gunn and Pitt, 2022). Cryptosporidium spp. are generally host-specific, with human cases predominantly attributed to C. parvum and C. hominis (Barbosa et al., 2023; Gunn and Pitt, 2022). Dogs are frequently documented harboring these zoonotic variants, in addition to their primary, host-adapted G. duodenalis assemblages C and D, and C. canis (Cai et al., 2021; Taghipour et al., 2020). Notably, these canine-specific genotypes have also been reported in humans, suggesting the risk is not negligible (Barbosa et al., 2023; Li et al., 2025; Yun et al., 2024). Therefore, dogs are considered potential reservoirs (Taghipour et al., 2020), though there is ongoing debate regarding the extent of this zoonotic risk (Smith et al., 2020). While some studies suggest no evidence of direct transmission from dogs to humans (de Lucio et al., 2017; Liao et al., 2020), others support the role of dogs in maintaining zoonotic transmission cycles (Hsu et al., 2023; Julien et al., 2019; Tangtrongsup et al., 2020). This variation may be attributed to differences in target populations and geographic locations.

The tropical climate of Vietnam, marked by high humidity and frequent heavy rainfall, creates optimal conditions for the survival of protozoan cysts and oocysts (Ahmed et al., 2025). Furthermore, agricultural practices in rural areas, such as the use of manure as fertilizer, potentially exacerbate environmental contamination (Iwashita et al., 2021). Previous studies in Vietnam have documented the presence of G. duodenalis and Cryptosporidium spp. in environmental samples (Nguyen et al., 2016, 2023; Tram et al., 2022), livestock (Cao et al., 2025; Geurden et al., 2008; Nguyen et al., 2012a, 2012b), and humans (Gatei et al., 2003; Iwashita et al., 2021).

There remains a significant scarcity of molecular epidemiological data in Vietnam, particularly regarding companion animals. Existing data on dogs are limited, with previous findings including an 8.6% prevalence of G. duodenalis (Nguyen et al., 2018) and the detection of C. canis in a single dog (Iwashita et al., 2021). Many previous studies relied on initial microscopic screening, which has lower sensitivity compared to molecular methods and may underestimate the true prevalence. Therefore, this study was conducted to evaluate the prevalence, determine the specific Giardia assemblages and Cryptosporidium species, and assess risk factors associated with these infections in dogs in Central Vietnam using nested PCR, aiming to elucidate the potential role of dogs in the zoonotic transmission of these parasites.

2 Materials and methods

2.1 Study area and sample collection

A cross-sectional study was conducted in Eaho and Eatam communes, Krong Nang district, Dak Lak province, Vietnam, from February to June 2025 (Figure 1). Households owning dogs in the selected communes were randomly chosen with the assistance of local authorities, and dogs within these households were then enrolled without restriction by sex, breed, or age.

Map of the study area and sampling locations in the Eaho and Eatam communes, Krong Nang district, Dak Lak province, Vietnam. Commune and district borders are shown as they were defined prior to July 2025. Map lines delineate study areas and do not necessarily depict accepted national boundaries.
Figure 1. Map of the study area and sampling locations in the Eaho and Eatam communes, Krong Nang district, Dak Lak province, Vietnam. Commune and district borders are shown as they were defined prior to July 2025. Map lines delineate study areas and do not necessarily depict accepted national boundaries.

The minimum sample size was determined using the formula described by Daniel and Cross (2013):

n=Z1−α/2 2P(1−P)d2

The calculation was based on an expected prevalence (P) of 8.6% (Nguyen et al., 2018), with a 95% confidence level (Z = 1.96) and a margin of error (d) of 3%. The final sample size was determined at 362 dogs, adjusting for a 7% anticipated sample exclusion rate.

Approximately 5–10 g of fresh feces was collected from the central portion of the stool of each dog following observed defecation and immediately aliquoted into sterile, labeled 2.0 mL microcentrifuge tubes containing 5% (w/v) potassium dichromate. The samples were transported to the Department of Parasitology, Faculty of Veterinary Medicine, Kasetsart University, for molecular analysis.

Epidemiological data were gathered via interviews with dog owners using a structured questionnaire covering demographic information (age and sex), deworming history, contact with other dogs, outdoor access, and bathing practices.

Ethical approval was granted by the primary academic institution for this research, the Institutional Animal Care and Use Committee of Kasetsart University, in accordance with the ethical guidelines of the National Research Council of Thailand (no. ACKU67-VET-098). The study was conducted with explicit permission from Krong Nang district authorities and informed consent from all dog owners prior to sample and data collection.

2.2 DNA extraction

Genomic DNA was extracted from approximately 200 mg of each fecal sample using the E.Z.N.A.® Stool DNA Kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s instructions. The DNA was eluted in 100 µL of elution buffer. The concentration and purity of the extracted DNA were measured using a NanoDrop™ One Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and the DNA extracts were stored at -20 °C until further analysis.

2.3 Molecular detection and genotyping

Molecular detection of G. duodenalis and Cryptosporidium spp. was performed on all genomic DNA samples using nested PCR targeting the small subunit ribosomal RNA (SSU rRNA) gene. All primer sequences used in this study are listed in Table 1.

Table 1. Oligonucleotide primers and cycling conditions used for the molecular detection and genotyping of G. duodenalis and Cryptosporidium spp. targeting the SSU rRNA gene.

Primer namePrimer sequences (5’-3’)Cycling conditionsSize (bp)Reference
*G. duodenalis*95 °C/15 min(95 °C/15 s58 °C/30 s72 °C/1 min) ×3572 °C/7 min
RH11CATCCGGTCGATCCTGCC292(Hopkins et al., 1997)
RH4AGTCGAACCCTGATTCTCCGCCAGG
GiarFGACGCTCTCCCCAAGGAC174(Read et al., 2002)
GiarRCTGCGTCACGCTGCTCG
**Cryptosporidium spp.**95 °C/15 min(94 °C/45 s55 °C/45 s68 °C/1 min) ×3568 °C/7 min
SSU-F1TTCTAGAGCTAATACATGCG1325(Xiao et al., 1999)
SSU-R1CCCATTTCCTTCGAAACAGGA(Xiao et al., 2000)
SSU-F2GGAAGGGTTGTATTTATTAGATAAAG840(Xiao et al., 1999)
SSU-R2CTCATAAGGTGCTGAAGGAGTA(Jiang et al., 2005)

PCR mixtures were prepared in a final volume of 20 µL, containing 4 µL of HOT FIREPol® Blend Master Mix Ready to Load, 5× (Solis BioDyne, Tartu, Estonia), 1 µL of each primer (10 µM), 12 µL of nuclease-free water, and 2 µL of genomic DNA for the primary PCR, or the primary PCR product for the nested reaction. Genomic DNA from dogs with confirmed G. duodenalis and Cryptosporidium spp. infections were included in each run as a positive control, and nuclease-free water as a negative control. All reactions were performed on a T100™ Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA).

PCR products were visualized by electrophoresis on a 1.5% agarose gel. Positive amplicons were excised and purified using the MEGAquick-spin™ Plus DNA Purification Kit (iNtRON Biotechnology, Seongnam, South Korea). The concentration of purified products was measured using a NanoDrop™ One Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

Purified amplicons were sequenced using the unidirectional Sanger method by U2Bio (Seoul, South Korea). Nucleotide sequences and chromatograms were inspected using SnapGene® Viewer version 8.2.2 (Dotmatics, Boston, MA, USA). Consensus sequences were compared with reference sequences available in the GenBank database using the Basic Local Alignment Search Tool (BLAST; https://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.4 Statistical analysis

Data were organized in Microsoft Excel and analyzed using IBM SPSS Statistics version 27 (IBM Corp., Armonk, NY, USA). Prevalence was estimated with 95% confidence intervals (CIs) using the Wilson score method. Pearson’s Chi-square or Fisher’s exact tests were performed for univariable analysis. Variables with P < 0.25 were analyzed via backward stepwise multivariable logistic regression. Final results are reported as adjusted odds ratios (aOR) with 95% CIs. Associations were considered statistically significant at P < 0.05.

3 Results

3.1 Molecular detection and genotyping of G. duodenalis and Cryptosporidium spp.

A total of 362 fecal samples were analyzed in this study. Based on nested PCR amplification of the SSU rRNA gene, the overall prevalence of G. duodenalis infection was 8.0% (29/362; 95% CI: 5.6–11.3%). In contrast, Cryptosporidium spp. DNA was not detected in any of the examined samples (0/362; 95% CI: 0.0–1.1%).

Amplicons of sufficient quality for sequencing were successfully obtained for 18 of the 29 Giardia-positive samples (62.1%). BLAST analysis showed that all 18 sequences shared 100% nucleotide identity with G. duodenalis assemblage D (GenBank accession no. JQ245138).

3.2 Risk factors associated with G. duodenalis infection

The results of the univariable and multivariable logistic regression analyses are summarized in Table 2. In the final multivariable model, contact with other dogs and bathing practices were identified as significant predictors of infection. Dogs with direct contact with other dogs had 7.55 times higher odds of Giardia positivity compared to those without such contact (aOR = 7.55; 95% CI: 1.69–33.82; P = 0.008). Bathing practices were significantly associated with infection status, where unbathed dogs had lower odds of infection than their bathed counterparts (aOR = 0.30; 95% CI: 0.11–0.83; P = 0.021). Although outdoor access passed the initial univariable screening, it was not retained in the final model (P = 0.833). Location, age, sex, and deworming history were not significantly associated with Giardia infection.

Table 2. Risk factors associated with G. duodenalis infection in owned dogs in Dak Lak province, Vietnam (n = 362).

VariableNo. examinedNo. positivePrevalenceUnivariable analysisP-valueMultivariable analysisP-value
(N)(n)(%)cOR (95% CI)aOR (95% CI)
Location
Eaho174169.2Ref.
Eatam188136.90.73 (0.34–1.57)0.425
Age group
> 12 months216156.9Ref.
≤ 12 months146149.61.42 (0.66–3.04)0.363
Sex
Female207146.8Ref.
Male155159.71.48 (0.69–3.16)0.312
Outdoor access
No8833.4Ref.——
Yes274269.52.97 (0.88–10.06)0.068——
Contact with other dogs
No10122.0Ref.Ref.
Yes2612710.35.71 (1.33–24.48)0.0097.55 (1.69–33.82)0.008**
Deworming history
Yes (≤ 12 months ago)9466.4Ref.
No/Never268238.61.38 (0.54–3.49)0.499
Bathing practice
Yes43614.0Ref.Ref.
No319237.20.48 (0.18–1.25)0.135a0.30 (0.11–0.83)0.021*

*P < 0.05, **P < 0.01. aP-value calculated using Fisher’s exact test. Dashes (—) indicate that the variable was not retained in the final parsimonious model following backward stepwise elimination (Wald P > 0.05). cOR, crude odds ratio; aOR, adjusted odds ratio.

4 Discussion

Accurate diagnosis of G. duodenalis and Cryptosporidium spp. is essential for both veterinary and public health (Abdelaziz and Sorour, 2021; Jian et al., 2024). G. duodenalis was detected in 8.0% of the sampled dogs. This rate is highly comparable to previous reports from Vietnam (8.6%) (Nguyen et al., 2018), China (9.4%) (Li et al., 2019), and Egypt (8.5%) (Abdelaziz and Sorour, 2021). While a lower prevalence (3.0%) was reported in Thailand (Khine et al., 2021), exceptionally high infection rates have been documented in European countries, such as Italy (41.1%) (Agresti et al., 2022), Spain (36.5%) (Adell-Aledón et al., 2018), and Portugal (33.8%) (Pereira et al., 2021). In the present study, Cryptosporidium spp. DNA was not detected. This finding aligns with the low prevalence of 0.7% observed in stray dogs in Thailand (Khine et al., 2021). Globally, the prevalence of Cryptosporidium spp. in companion animals is heterogeneous but typically remains below 10% across North America, Europe, the Western Pacific, and Asia (Nahar et al., 2026; Taghipour et al., 2020). In Asia, infection rates have been documented at 4.2% in Bangladesh (Nahar et al., 2026), 6.9% in China (Li et al., 2019), and 8.4% in Taiwan (Hsu et al., 2023). These prevalence variations for G. duodenalis and Cryptosporidium spp. can be attributed to environmental conditions, seasonality, host demographics, and the diagnostic methods employed (Liao et al., 2020; Mugala et al., 2018; Yun et al., 2024).

Determining the specific assemblages of G. duodenalis is critical for elucidating its zoonotic potential (Pereira et al., 2021). In this study, all successfully sequenced isolates were identified as the canine-specific assemblage D. This finding is consistent with global trends, where assemblages C and D predominate in dog populations (Nahar et al., 2026; Sun et al., 2023), as well as with previous data from Vietnam (Nguyen et al., 2018) and China (Li et al., 2019). While studies in Thailand also report a predominance of canine-specific genotypes, they have concurrently documented the presence of the zoonotic assemblage A (Khine et al., 2021). Since only assemblage D was detected, the direct zoonotic risk to the local human population appears minimal (Nguyen et al., 2018). However, this risk cannot be disregarded, as human infections with canine-specific assemblages C and D have been documented (Sun et al., 2023).

In the present study, direct contact with other dogs was a significant risk factor for Giardia infection, while outdoor access was not. In these rural communes, owned dogs with outdoor access are unrestrained and roam freely. This finding regarding rearing environment aligns with Sun et al. (2023) and Nahar et al. (2026), reporting no significant difference in Giardia prevalence between free-roaming and indoor dogs. Furthermore, the relatively low Giardia prevalence (8.0%) observed in this study suggests that widespread environmental contamination is limited. Thus, transmission in this population might be driven primarily by dog-to-dog interactions rather than general environmental exposure. Since Giardia cysts are immediately infective upon excretion (Simonato et al., 2017), direct contact between animals constitutes a primary pathway for fecal-oral transmission (Yu et al., 2017). Bathed dogs demonstrated higher odds of infection than unbathed dogs. Bathing might act both as an epidemiological proxy for prior exposure and as a mechanical driver of transmission. Owners typically wash dogs reactively, often following fecal soiling, indicating heavy prior exposure. While routine bathing is recommended to remove fecal debris and prevent reinfection from cysts on the fur (Saleh et al., 2016), the subsequent drying phase can create a transmission risk. The general practice in these rural settings is to allow bathed dogs to dry naturally. Since Giardia cysts can survive longer in moist environments, this prolonged dampness maintains cyst viability on the hair coat. Given the low infectious dose of Giardia, requiring as few as 10 cysts to cause infection (Ciuca et al., 2021; Godínez-Galaz et al., 2019), this moisture retention may increase the risk of infection during self-grooming. This improper drying interacts with conspecific social behavior to facilitate transmission. When unrestrained dogs with cyst-contaminated damp coats engage in social interactions, these viable cysts can pose an infection risk for interacting dogs. Transmission may occur through natural conspecific behaviors, including sniffing, licking, mutual grooming, and playful biting. Effective management of Giardia infection requires an integrated approach (Saleh et al., 2016). Owners should be advised to wash their dogs using appropriate antiprotozoal shampoos (e.g., containing chlorhexidine digluconate) (Ciuca et al., 2021) and to thoroughly dry the fur to facilitate cyst desiccation. This hygiene protocol, combined with targeted therapeutics (e.g., fenbendazole), and the restriction of animal interactions is recommended to reduce the risk of transmission.

Deworming history showed no statistically significant association with Giardia infection, consistent with findings by Nahar et al. (2026). This finding is likely due to the highly variable timing of prior treatments. While Sun et al. (2023) reported that deworming within the previous month significantly reduced infection rates, our study recorded deworming history over a broader span of up to 12 months prior to sampling. Given the frequent interaction between dogs in these rural communes, there are ongoing opportunities for exposure over time. An anthelmintic treatment administered several months prior would no longer offer direct protection. Therefore, deworming history over this extended timeframe was not a significant predictor of infection. Demographic variables (sex and age) were not significantly associated with Giardia infection. The lack of a sex association is widely reported (Abdelaziz and Sorour, 2021; Adell-Aledón et al., 2018; Hsu et al., 2023; Khine et al., 2021; Sun et al., 2023). This finding suggests that extrinsic variables, such as living routines, exert a far greater influence on Giardia infection than the sex of the host (Šmit et al., 2023). Similarly, the age-independent pattern observed in our study aligns with previous research (Khine et al., 2021; Li et al., 2019; Nahar et al., 2026). While several studies have reported a higher prevalence of Giardia in young animals under 12 months of age due to an immature immune system and a lack of acquired immunity (Kurnosova et al., 2024; Nguyen et al., 2018; Sun et al., 2023), comparable prevalence rates are also reported for older dogs, likely due to reinfection or persistent subclinical infections (Hamnes et al., 2007). In the surveyed rural communes, improper hygiene and unrestricted conspecific contact create an ongoing infection risk for adult dogs. Although puppies possess immunological vulnerabilities, they typically roam less frequently than adults, thereby reducing their relative risk for direct contact with other dogs, potentially explaining the lack of an age association. These results support the conclusion that management practices dictate Giardia infection dynamics far more than individual host characteristics (Nahar et al., 2026).

The present study was unable to record specific treatment timelines and anthelmintic products due to inherent recall variability. In addition, the single cross-sectional fecal sampling conducted during the dry season may underestimate the true prevalence, given the intermittent shedding patterns of Giardia cysts and Cryptosporidium oocysts. Assemblage determination for G. duodenalis relied solely on the highly conserved SSU rRNA locus. Although multilocus genotyping was attempted, amplification was unsuccessful. This is a widely recognized diagnostic challenge, as the low cyst shedding typical of asymptomatic dogs frequently yields insufficient DNA to amplify single-copy targets (Gil et al., 2017; Sommer et al., 2018). Future studies would benefit from longitudinal sampling designs and multilocus genotyping targeting single-copy genes, such as triosephosphate isomerase (tpi), glutamate dehydrogenase (gdh), and beta-giardin (bg), to establish more precise prevalence rates, enhance genotyping resolution, elucidate transmission dynamics, and evaluate the effect of seasonality on protozoan transmission. As molecular epidemiological data for companion animals in Vietnam remain sparse, conducting surveillance across other geographic regions is highly recommended to build a comprehensive understanding of these parasites nationwide.

This study provides updated molecular epidemiological and ecological data on enteric protozoans in owned dogs in Central Vietnam. Molecular detection revealed an 8.0% prevalence of G. duodenalis and no detectable Cryptosporidium spp. infections. Sequence analysis exclusively identified the canine-specific assemblage D, indicating that these companion animals currently present a negligible zoonotic threat to their owners. The findings suggest a highly host-adapted transmission cycle of canine giardiasis within this rural ecosystem, where widespread environmental contamination appears limited. Rather than being driven by individual host demographics, Giardia infection dynamics here are dictated by a critical intersection of biological and management variables: specifically, unrestrained conspecific social interactions among dogs and prolonged cyst viability due to moisture retention following improper bathing practices. Therefore, targeted interventions focusing on implementing proper drying protocols and restricting uncontrolled dog-to-dog interactions are crucial to disrupt this parasite transmission cycle. Integrating these targeted management practices with expanded molecular surveillance will be essential for comprehensively mapping and mitigating protozoan transmission across similar agricultural communities.

Generative AI statement

The author(s) declared that Generative AI was used in the creation of this manuscript. During the preparation of this work the author(s) used Gemini in order to assist with the language and improve the readability of the manuscript. After using this tool/service, the author(s) reviewed and edited the content as needed and take full responsibility for the content of the published article.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Footnotes

Edited by: Victor Midlej, Oswaldo Cruz Foundation, Brazil

Reviewed by: Diana Maritza Echeverry Berrio, Universidad San Sebastián, Chile

Dilia Fontalvo Rivera, Universidad del Sinu - Seccional Cartagena, Colombia

Statements

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This work was supported by the Faculty of Veterinary Medicine, Kasetsart University (CVRI.VET.KU2026-RF20); and the Thailand Scholarships (Year 2025), awarded by the Ministry of Higher Education, Science, Research and Innovation, Thailand, and Kasetsart University.

Data availability

The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.

Ethics approval

The animal studies were approved by the Institutional Animal Care and Use Committee of Kasetsart University, in accordance with the ethical guidelines of the National Research Council of Thailand. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study.

Author contributions

VL: Data curation, Formal Analysis, Investigation, Visualization, Writing – original draft. M-TH: Data curation, Investigation, Writing – review & editing. V-PN: Investigation, Writing – review & editing. DN-N: Investigation, Writing – review & editing. TI: Conceptualization, Funding acquisition, Methodology, Project administration, Resources, Supervision, Validation, Writing – review & editing.

Acknowledgements

The authors are grateful for the assistance of Mrs. Thuy Kim Bui and the veterinary students of the Department of Veterinary Medicine, Faculty of Agriculture, Tay Nguyen University, and the cooperation of local authorities and dog owners in Krong Nang district, Dak Lak province, Vietnam, during sample collection.

References

  1. Abdelaziz A. R., Sorour S. S. G. (2021). Prevalence and molecular characterization of Giardia duodenalis assemblage D of dogs in Egypt, and its zoonotic implication. Microbes Infect. Chemother. 1, e1268. doi: doi:10.54034/MIC.E1268
  2. Adell-Aledón M., Köster P. C., de Lucio A., Puente P., Hernández-de-Mingo M., Sánchez-Thevenet P.. (2018). Occurrence and molecular epidemiology of Giardia duodenalis infection in dog populations in eastern Spain. BMC Vet. Res. 14, 26. doi:. PMID: doi:10.1186/s12917-018-1353-z
  3. Agresti A., Berrilli F., Maestrini M., Procesi I. G., Loretti E., Vonci N.. (2022). Prevalence, risk factors and genotypes of Giardia duodenalis in sheltered dogs in Tuscany (Central Italy). Pathogens 11, 12. doi:. PMID: doi:10.3390/pathogens11010012
  4. Ahmed S. A. A., Boughattas S., Mahmoudi M. R., Khan H., Mamedova S., Namboodiri A.. (2025). Cryptosporidium and cryptosporidiosis: An update of Asian perspectives in humans, water and food 2015–2025. Curr. Res. Parasitol. Vector-Borne Dis. 8, 100311. doi:. PMID: doi:10.1016/j.crpvbd.2025.100311
  5. Barbosa A. D., Egan S., Feng Y., Xiao L., Ryan U. (2023). Cryptosporidium and Giardia in cats and dogs: What is the real zoonotic risk ? Curr. Res. Parasitol. Vector-Borne Dis. 4, 100158. doi:. PMID: doi:10.1016/j.crpvbd.2023.100158
  6. Cai W., Ryan U., Xiao L., Feng Y. (2021). Zoonotic giardiasis: an update. Parasitol. Res. 120, 4199 – 4218. doi:. PMID: doi:10.1007/s00436-021-07325-2
  7. Cao L. C., Muraleedharan D., Giang T. T., Tiep V. M., Chau N. T. M., Anh T. N. P.. (2025). Prevalence and genetic diversity of Entamoeba and Cryptosporidium in pigs and wild boars in Central and Southern Vietnam: Implications for zoonotic risks and surveillance. Foodborne Pathog. Dis. 22, 525 – 531. doi:. PMID: doi:10.1089/fpd.2024.0095
  8. Ciuca L., Pepe P., Bosco A., Cacciò S. M., Maurelli M. P., Sannella A. R.. (2021). Effectiveness of fenbendazole and metronidazole against Giardia infection in dogs monitored for 50-days in home-conditions. Front. Vet. Sci. 8, 626424. doi:. PMID: doi:10.3389/fvets.2021.626424
  9. Daniel W. W., Cross C. L. (2013). Biostatistics: A foundation for analysis in the health sciences (New York, NY: John Wiley & Sons, Inc).
  10. de Lucio A., Bailo B., Aguilera M., Cardona G. A., Fernández-Crespo J. C., Carmena D. (2017). No molecular epidemiological evidence supporting household transmission of zoonotic Giardia duodenalis and Cryptosporidium spp. from pet dogs and cats in the province of Álava, Northern Spain. Acta Trop. 170, 48 – 56. doi:. PMID: doi:10.1016/j.actatropica.2017.02.024
  11. Dong S., Yang Y., Wang Y., Yang D., Yang Y., Shi Y.. (2020). Prevalence of Cryptosporidium infection in the global population: A systematic review and meta-analysis. Acta Parasitol. 65, 882 – 889. doi:. PMID: doi:10.2478/s11686-020-00230-1
  12. Erickson M. C., Ortega Y. R. (2006). Inactivation of protozoan parasites in food, water, and environmental systems. J. Food Prot. 69, 2786 – 2808. doi:. PMID: doi:10.4315/0362-028X-69.11.2786
  13. Gatei W., Greensill J., Ashford R. W., Cuevas L. E., Parry C. M., Cunliffe N. A.. (2003). Molecular analysis of the 18S rRNA gene of Cryptosporidium parasites from patients with or without human immunodeficiency virus infections living in Kenya, Malawi, Brazil, the United Kingdom, and Vietnam. J. Clin. Microbiol. 41, 1458 – 1462. doi:. PMID: doi:10.1128/jcm.41.4.1458-1462.2003
  14. Geurden T., Somers R., Thanh N. T. G., Vien L. V., Nga V. T., Giang H. H.. (2008). Parasitic infections in dairy cattle around Hanoi, northern Vietnam. Vet. Parasitol. 153, 384 – 388. doi:. PMID: doi:10.1016/j.vetpar.2008.01.031
  15. Gil H., Cano L., de Lucio A., Bailo B., de Mingo M. H., Cardona G. A.. (2017). Detection and molecular diversity of Giardia duodenalis and Cryptosporidium spp. in sheltered dogs and cats in Northern Spain. Infect. Genet. Evol. 50, 62 – 69. doi:. PMID: doi:10.1016/j.meegid.2017.02.013
  16. Godínez-Galaz E. M., Veyna-Salazar N. P., Olvera-Ramírez A. M., Milián-Suazo F., Perea-Razo C. A., Bernal-Reynaga R.. (2019). Prevalence and zoonotic potential of Giardia intestinalis in dogs of the central region of Mexico. Animals 9, 325. doi:. PMID: doi:10.3390/ani9060325
  17. Gunn A., Pitt S. J. (2022). Parasitology: an integrated approach (Chichester: John Wiley & Sons Ltd).
  18. Hamnes I. S., Gjerde B. K., Robertson L. J. (2007). A longitudinal study on the occurrence of Cryptosporidium and Giardia in dogs during their first year of life. Acta Vet. Scand. 49, 22. doi:. PMID: doi:10.1186/1751-0147-49-22
  19. Hopkins R. M., Meloni B. P., Groth D. M., Wetherall J. D., Reynoldson J. A., Thompson R. C. A. (1997). Ribosomal RNA sequencing reveals differences between the genotypes of Giardia isolates recovered from humans and dogs living in the same locality. J. Parasitol. 83, 44 – 51. doi: doi:10.2307/3284315
  20. Hsu C. H., Liang C., Chi S. C., Lee K. J., Chou C. H., Lin C. S.. (2023). An epidemiological assessment of Cryptosporidium and Giardia spp. infection in pet animals from Taiwan. Animals 13, 3373. doi:. PMID: doi:10.3390/ani13213373
  21. Iwashita H., Takemura T., Tokizawa A., Sugamoto T., Thiem V. D., Nguyen T. H.. (2021). Molecular epidemiology of Cryptosporidium spp. in an agricultural area of northern Vietnam: A community survey. Parasitol. Int. 83, 102341. doi:. PMID: doi:10.1016/j.parint.2021.102341
  22. Jian J., Liu A., Yang Y., Peng X., Yao L., Li B.. (2024). Occurrence rate and species and subtypes of Cryptosporidium spp. in pet dogs in Yunnan Province, China. BMC Microbiol. 24, 354. doi:. PMID: doi:10.1186/s12866-024-03500-4
  23. Jiang J., Alderisio K. A., Xiao L. (2005). Distribution of Cryptosporidium genotypes in storm event water samples from three watersheds in New York. Appl. Environ. Microbiol. 71, 4446 – 4454. doi:. PMID: doi:10.1128/AEM.71.8.4446-4454.2005
  24. Julien D. A., Sargeant J. M., Guy R. A., Shapiro K., Imai R. K., Bunce A.. (2019). Prevalence and genetic characterization of Giardia spp. and Cryptosporidium spp. in dogs in Iqaluit, Nunavut, Canada. Zoonoses Public Health 66, 813 – 825. doi:. PMID: doi:10.1111/zph.12628
  25. Khine N. O., Chimnoi W., Kamyingkird K., Kengradomkij C., Saetiew N., Simking P.. (2021). Molecular detection of Giardia duodenalis and Cryptosporidium spp. from stray dogs residing in monasteries in Bangkok, Thailand. Parasitol. Int. 83, 102337. doi:. PMID: doi:10.1016/j.parint.2021.102337
  26. Kurnosova O. P., Panova O. A., Arisov M. V. (2024). Prevalence of Giardia duodenalis in dogs and cats: age-related predisposition, symptomatic, and asymptomatic cyst shedding. Vet. World 17, 379 – 383. doi:. PMID: doi:10.14202/vetworld.2024.379-383
  27. Li J., Dan X., Zhu K., Li N., Guo Y., Zheng Z.. (2019). Genetic characterization of Cryptosporidium spp. and Giardia duodenalis in dogs and cats in Guangdong, China. Parasitol. Vectors 12, 571. doi:. PMID: doi:10.1186/s13071-019-3822-z
  28. Li S. A., Lin Y. L., Bai Y. P., Wen F., Huang L. Y., Miao W. Y.. (2025). Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in humans and dogs from Fujian Province, Southeast China. Food Waterborne Parasitol. 40, e00278. doi:. PMID: doi:10.1016/j.fawpar.2025.e00278
  29. Liao S., Lin X., Sun Y., Qi N., Lv M., Wu C.. (2020). Occurrence and genotypes of Cryptosporidium spp. Giardia duodenalis, and Blastocystis sp. in household, shelter, breeding, and pet market dogs in Guangzhou, southern China. Sci. Rep. 10, 17736. doi:. PMID: doi:10.1038/s41598-020-74299-z
  30. Mugala L., Siwila J., Saasa N., Pandey G. S. (2018). Prevalence of Cryptosporidium spp. oocysts in dogs in Lusaka district of Zambia. Vet. World 11, 585 – 589. doi:. PMID: doi:10.14202/vetworld.2018.585-589
  31. Nahar A., Hasan M. F., Harun A. B., Bayazid A. A., Sultana T., Rehena J.. (2026). Molecular detection and zoonotic potential of Cryptosporidium spp. and Giardia duodenalis in cats and dogs from metropolitan areas of Bangladesh. Food Waterborne Parasitol. 42, e00314. doi:. PMID: doi:10.1016/j.fawpar.2025.e00314
  32. Nguyen S. T., Fukuda Y., Nguyen D. T., Dao H. T., Le D. Q., Bui K. L.. (2018). Prevalence, genotyping and risk factors of Giardia duodenalis from dogs in Vietnam. J. Vet. Med. Sci. 80, 92 – 97. doi:. PMID: doi:10.1292/jvms.17-0498
  33. Nguyen S. T., Fukuda Y., Tada C., Sato R., Duong B., Nguyen D. T.. (2012 a). Molecular characterization of Cryptosporidium in native beef calves in central Vietnam. Parasitol. Res. 111, 1817 – 1820. doi:. PMID: doi:10.1007/s00436-012-3038-z
  34. Nguyen S. T., Fukuda Y., Tada C., Sato R., Huynh V. V., Nguyen D. T.. (2012 b). Molecular characterization of Cryptosporidium in pigs in central Vietnam. Parasitol. Res. 112, 187 – 192. doi:. PMID: doi:10.1007/s00436-012-3124-2
  35. Nguyen T. T., Le T. T., Le H. H., Tang T. N., Phung T. T. H., Vu T. M. H.. (2023). Molecular characterization of Cryptosporidium and Giardia in environmental samples and faecal samples from biogas users in Bac Giang, Vietnam. Sci. Total Environ. 884, 163728. doi:. PMID: doi:10.1016/j.scitotenv.2023.163728
  36. Nguyen T. T., Traub R., Pham P. D., Nguyen H. V., Nguyen K. C., Phung C. D.. (2016). Prevalence and molecular characterization of Cryptosporidium spp. and Giardia spp. in environmental samples in Hanam province, Vietnam. Food Waterborne Parasitol. 3, 13 – 20. doi:. PMID: doi:10.1016/j.fawpar.2016.03.003
  37. Pereira A., Teixeira J., Sousa S., Parreira R., Campino L., Meireles J.. (2021). Giardia duodenalis infection in dogs from the metropolitan area of Lisbon, Portugal: prevalence, genotyping and associated risk factors. J. Parasitol. Dis. 45, 372 – 379. doi:. PMID: doi:10.1007/s12639-020-01307-4
  38. Rana T. (Ed.) (2024). Principles and practices of canine and feline clinical parasitic diseases (Hoboken, NJ: John Wiley & Sons, Inc).
  39. Read C., Walters J., Robertson I. D., Thompson R. C. A. (2002). Correlation between genotype of Giardia duodenalis and diarrhoea. Int. J. Parasitol. 32, 229 – 231. doi:. PMID: doi:10.1016/S0020-7519(01)00340-X
  40. Saari S., Näreaho A., Nikander S. (2019). Canine parasites and parasitic diseases (San Diego, CA: Academic Press).
  41. Saleh M. N., Gilley A. D., Byrnes M. K., Zajac A. M. (2016). Development and evaluation of a protocol for control of Giardia duodenalis in a colony of group-housed dogs at a veterinary medical college. J. Am. Vet. Med. Assoc. 249, 644 – 649. doi:. PMID: doi:10.2460/javma.249.6.644
  42. Santin M. (2020). Cryptosporidium and giardia in ruminants. Vet. Clin. North. Am. Food. Anim. Pract. 36, 223 – 238. doi:. PMID: doi:10.1016/j.cvfa.2019.11.005
  43. Simonato G., Frangipane di Regalbono A., Cassini R., Traversa D., Tessarin C., Di Cesare A.. (2017). Molecular detection of Giardia duodenalis and Cryptosporidium spp. in canine faecal samples contaminating public areas in Northern Italy. Parasitol. Res. 116, 3411 – 3418. doi:. PMID: doi:10.1007/s00436-017-5671-z
  44. Šmit I., Potočnjak D., Matijatko V., Torti M., Jović I., Grden D.. (2023). The influence of Giardia duodenalis on the occurrence of clinical signs in dogs. Vet. Sci. 10, 694. doi:. PMID: doi:10.3390/vetsci10120694
  45. Smith A. F., Neumann N., Banting G., Klein C., Liccioli S., Massolo A. (2020). Molecular characterization of Giardia spp. and Cryptosporidium spp. from dogs and coyotes in an urban landscape suggests infrequent occurrence of zoonotic genotypes. Vet. Parasitol. 281, 109115. doi:. PMID: doi:10.1016/j.vetpar.2020.109115
  46. Sommer M. F., Rupp P., Pietsch M., Kaspar A., Beelitz P. (2018). Giardia in a selected population of dogs and cats in Germany - diagnostics, coinfections and assemblages. Vet. Parasitol. 249, 49 – 56. doi:. PMID: doi:10.1016/j.vetpar.2017.11.006
  47. Sun J., Qin Z., Fu Y., Qin H., Sun M., Dong H.. (2023). Assessment of potential zoonotic transmission of Giardia duodenalis from dogs and cats. One Health 17, 100651. doi:. PMID: doi:10.1016/j.onehlt.2023.100651
  48. Sykes J. E. (Ed.) (2023). Greene’s infectious diseases of the dog and cat (St. Louis, MO: Elsevier).
  49. Szydłowicz M., Zajączkowska Ż., Lewicka A., Łukianowski B., Kamiński M., Holubová N.. (2024). Host-specific Cryptosporidium, Giardia and Enterocytozoon bieneusi in shelter dogs from central Europe. Parasitology 151, 351 – 362. doi:. PMID: doi:10.1017/S003118202400009X
  50. Taghipour A., Olfatifar M., Bahadory S., Godfrey S. S., Abdoli A., Khatami A.. (2020). The global prevalence of Cryptosporidium infection in dogs: A systematic review and meta-analysis. Vet. Parasitol. 281, 109093. doi:. PMID: doi:10.1016/j.vetpar.2020.109093
  51. Tangtrongsup S., Scorza A. V., Reif J. S., Ballweber L. R., Lappin M. R., Salman M. D. (2020). Seasonal distributions and other risk factors for Giardia duodenalis and Cryptosporidium spp. infections in dogs and cats in Chiang Mai, Thailand. Prev. Vet. Med. 174, 104820. doi:. PMID: doi:10.1016/j.prevetmed.2019.104820
  52. Tram N. T., Phuc P. D., Phi N. H., Trang L. T., Nga T. T., Ha H. T. T.. (2022). Cryptosporidium and Giardia in biogas wastewater: Management of manure livestock and hygiene aspects using influent, effluent, sewage canal samples, vegetable, and soil samples. Pathogens 11, 174. doi:. PMID: doi:10.3390/pathogens11020174
  53. Xiao L., Alderisio K., Limor J., Royer M., Lal A. A. (2000). Identification of species and sources of Cryptosporidium oocysts in storm waters with a small-subunit rRNA-based diagnostic and genotyping tool. Appl. Environ. Microbiol. 66, 5492 – 5498. doi:. PMID: doi:10.1128/AEM.66.12.5492-5498.2000
  54. Xiao L., Escalante L., Yang C., Sulaiman I., Escalante A. A., Montali R. J.. (1999). Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl. Environ. Microbiol. 65, 1578 – 1583. doi:. PMID: doi:10.1128/AEM.65.4.1578-1583.1999
  55. Yu Z., Ruan Y., Zhou M., Chen S., Zhang Y., Wang L.. (2017). Prevalence of intestinal parasites in companion dogs with diarrhea in Beijing, China, and genetic characteristics of Giardia and Cryptosporidium species. Parasitol. Res. 117, 35 – 43. doi:. PMID: doi:10.1007/s00436-017-5631-7
  56. Yun C. S., Moon B. Y., Lee K., Hwang S. H., Ku B. K., Hwang M. H. (2024). Prevalence and genotype analysis of Cryptosporidium and Giardia duodenalis from shelter dogs in South Korea. Vet. Parasitol. Reg. Stud. Rep. 55, 101103. doi:. PMID: doi:10.1016/j.vprsr.2024.101103

Citation

Le, V. T. T., et al. (2026). Molecular detection of Giardia duodenalis and the absence of Cryptosporidium spp. in owned dogs from Central Vietnam. Frontiers in Parasitology, Volume 5. https://doi.org/
Received
Accepted
Published
Volume
5 - 2026

Copyright

Copyright © 2026 Le, Hoang, Ngo, Ng-Nguyen and Inpankaew.

License: https://creativecommons.org/licenses/by/4.0/

*Correspondence: Tawin Inpankaew

Article metrics

Views
0
Downloads
0
Citations
0
Shares
0

Related articles

CorrectionCorrection: Evaluation of real-time LAMP assay for detection of Entamoeba species in clinical stool samples from a tertiary care center in North IndiaFrontiers Production OfficeOriginal ResearchPlasmodium falciparum putative Hsp90 functionally complements yeast Hsp90 and is inhibited in an isoform-specific mannerShradha Ravindra Khamitkar, Monalisa Bag, Vaibhav R. Kini, Mansi Singh, Badal Kumar Sethi, Sunanda BhattacharyyaOriginal ResearchEffect of urine storage conditions on circulating anodic antigen detection using the UCP-LF CAA testPytsje T. Hoekstra, Govert J. van Dam, Maureen Blokland-Flink, Danielle de Jong, Said M. Ali, Mohammed N. Ali, Naomi C. Ndum, Stefanie Knopp, Paul L.A.M. Corstjens, Lisette van Lieshout